methods and products for transfecting cells

专利摘要:
METHOD FOR REPROGRAMMING A CELL FOR A LESS DIFFERENTIATED STATE, CELL CULTURE MEDIA, KIT, COMPOSITION AND METHOD FOR EDITING A BIOLOGICAL CELL GENEThe present invention relates in part to nucleic acids encoding proteins, nucleic acids containing non-canonical nucleotides, therapy comprising nucleic acids, methods, kits and devices to induce cells to express proteins, methods, kits and devices to transfect, edit gene and reprogram cells and cells, organisms and therapies produced using these methods, kits and devices. Methods for inducing cells to express proteins and for reprogramming and editing genes in cells using RNA are disclosed. Methods for producing cells from patient samples, cells produced using these methods and therapeutics comprising cells produced using these methods are also disclosed.
公开号:BR112014013664A2
申请号:R112014013664-5
申请日:2012-12-05
公开日:2020-11-03
发明作者:Matthew Angel；Christopher Rohde
申请人:Factor Bioscience Inc.；
IPC主号:

专利说明:

[1] [1] The present order claims priority for Provisional Order US 61 / 566,948, filed on December 5, 2011, Provisional Order US 61 / 569,595, filed on December 12, 2011, Provisional Order US 61 / 637,570, filed on 24 April 2012, Order US 13 / 465,490, filed on May 7, 2012 and Provisional Order US 61 / 664,494, filed on June 26, 2012, which are all incorporated herein by reference in their entirety. FIELD OF THE INVENTION
[2] [2] The present invention relates in part to nucleic acids encoding proteins, nucleic acids containing non-canonical nucleotides, drugs comprising nucleic acids, methods, kits and devices for inducing cells to express proteins, methods, kits and devices for transfection, gene editing and reprogramming of cells and cells, organisms and drugs produced using these methods, kits and devices. DESCRIPTION OF THE TEXT FILE SENT ELECTRONICALLY
[3] [3] The content of the text file sent electronically is incorporated here as a reference in its entirety: a computer-readable copy of the Sequence Listing (file name: FABI_001_01WO_SeqList_ST25.txt; recorded date: December 4, 2012; size of the file: 18 KB).
[4] [4] Nucleic acids can be released to cells in vitro and in vivo by pre-complexing nucleic acids with charged lipids, lipids, peptides, polymers or mixtures thereof. These transfection reagents are commercially available and are widely used to deliver nucleic acids to cells in culture. Cells exposed to nucleic acid transfection reagent complexes can internalize these complexes by endocytosis or other means. Once inside a cell, the nucleic acid can perform its intended biological function. In the case of RNA encoding protein, for example, RNA can be translated into proteins by the cell's ribosomes. Serum-Free Cell Culture
[5] [5] Sera from animals such as fetal bovine serum (FBS) are commonly used as a supplement in cell culture media to promote the growth of many types of cells. However, the indefinite nature of the serum makes cells that contact this component undesirable for research and therapeutic applications. As a result, serum-free cell culture media have been developed to eliminate batch variability and the risk of contamination with toxic and / or pathogenic substances that are associated with serum.
[6] [6] The most abundant protein in serum is serum albumin. Serum albumin binds to a wide variety of molecules in vitro and in vivo, including hormones, fatty acids, calcium and metal ions and small molecule drugs and can transport these molecules to cells in vitro and in vivo. Serum albumin (most often bovine serum albumin (BSA) or human serum albumin (HSA)) is a common ingredient in serum-free cell culture medium, where it is normally used in a concentration of 1-10g / L. Serum albumin is traditionally prepared from blood plasma by ethanol fractionation (the "Cohn" process). The fraction containing serum albumin (“Fraction of
[7] [7] Serum albumin can be treated for use in certain specialized applications (See Barker A method for the deionization of bovine serum albumin. Tissue Culture Association. 1975; Droge et al. Biochem Pharmacol. 1982; 31: 3775-9; Ng et al. Nat Protoc. 2008; 3: 768-76; US Patent Application Publication 2010/0168000, the contents of which are hereby incorporated by reference). These treatment processes are most commonly used to remove globulins and contaminating viruses from serum albumin solutions, and often include stabilization of the serum albumin polypeptide by adding short-chain fatty acid, octanoic acid, followed by heat inactivation / precipitation of contaminants. For highly specialized stem cell culture applications, the use of an ion exchange resin to remove excess salt from BSA solutions has been shown to increase cell viability (see Ng et al. Nat Protoc. 2008; 3: 768-76 ; US Patent Application Publication 2010/0168000, the contents of which are hereby incorporated by reference). However, recombinant serum albumin does not benefit from this treatment, even in the same sensitive stem cell culture applications (See Ng et al. Nat Protoc. 2008; 3: 768-76; US Patent Application Publication 2010/0168000 , whose contents are hereby incorporated by reference), demonstrating that the deionization effect in these applications is to remove excess salt from the albumin solution and not to alter the component associated with the albumin molecule. In addition, the effect of this treatment on other cell types such as human fibroblasts and the effect of that treatment on transfection efficiency and transfection-associated toxicity have not been previously explored. In addition, albumin-associated lipids have been shown to be critical for culturing human pluripotent stem cells, and their removal has been shown to result in spontaneous differentiation of human pluripotent stem cells, even when lipids are added separately to the cell culture medium (See Garcia-Gonzalo et al. PLoS One. 2008; 3: el384, the contents of which are incorporated herein by reference). Thus, a cell culture medium containing albumin with an unmodified molecule-associated component is thought to be critical for the culture of human pluripotent stem cells. Importantly, the relationship between the component associated with the lipid carrier molecule such as albumin and the transfection efficiency and toxicity associated with transfection have not been explored previously. Cellular Reprogramming
[8] [8] Cells can be reprogrammed by exposing them to specific extracellular signals and / or by ectopic expression of specific proteins, microRNAs, etc. While several reprogramming methods have been described previously, most of those that rely on ectopic expression require the introduction of exogenous DNA, which can lead to mutation risks. DNA-free reprogramming methods based on direct release of reprogramming proteins have been reported, however, these methods are very inefficient and unreliable for commercial use. In addition, RNA-based reprogramming methods have been described, however, existing RNA-based reprogramming methods are slow, unreliable and inefficient when performed on adult cells, requiring many transfections (resulting in significant expense and opportunity for error), can reprogram only a limited number of cell types, may reprogram cells for only a limited number of cell types, require the use of immunosuppressants and require the use of various human-derived components, including blood-derived HSA and human fibroblast feeders. The many disadvantages of the previously described cell reprogramming methods make them undesirable for therapeutic and research use. Gene Edition
[9] [9] Several naturally occurring proteins contain DNA-binding domains that can recognize specific DNA sequences, for example, zinc fingers (ZFs) and transcription activator-type effectors (TALEs). Fusion proteins containing one or more DNA-binding domains and the catalytic domain of a nuclease can be used to create a double strand break in a desired region of DNA in a cell. When combined with a DNA model containing one or more regions of cell DNA homology, gene editing proteins can be used to insert a DNA sequence or to otherwise alter the cell's DNA sequence in a controlled manner. However, the most current methods for gene editing cells use DNA-based vectors to express gene editing proteins. As a result, these gene editing methods are inefficient and carry a risk of uncontrolled mutagenesis, making them undesirable for therapeutic and research use. Methods for somatic cell DNA free gene editing have not been explored previously, nor do they have methods for simultaneous or sequential gene editing and somatic cell reprogramming. Finally, the use of gene editing in an antibacterial, antiviral or anticancer treatment has not been previously explored. Model Organisms
[10] [10] Knockout rats were generated by embryo microinjection of nucleic acids encoding zinc finger nucleases TALE nucleases (TALENs). Gene editing to introduce sequence-specific mutations (also known as "knockins") has also been reported in mice and rats injecting nucleic acids that encode zinc finger nucleases into embryos. Genetically modified rats were generated using embryonic stem cells and pluripotent stem cells from competent germ line were generated by reprogramming somatic cells. However, the use of reprogrammed gene editing cells to generate genetically modified organisms, including mice and rats, has not previously been explored.
[11] [11] There is a need in the field for improved methods and products for transfecting cells. SUMMARY OF THE INVENTION
[12] [12] Therefore, the present invention provides reagents, kits, protocols and devices for inducing cells to express proteins and for transfecting, reprogramming and gene editing the cells. Unlike the methods previously reported, certain embodiments of the present invention do not involve presenting cells to exogenous DNA or materials derived from animals or allogeneics.
[13] [13] In one aspect, the invention provides a synthetic RNA molecule comprising three or more non-canonical nucleotides, each of which includes one or more substitutions of the following: pyrimidine position 2C, pyrimidine position 4C, pyrimidine position 5C, purine position 6C, purine position
[14] [14] In another aspect, the invention provides a synthetic RNA molecule that comprises a non-canonical nucleotide and encodes a gene editing protein.
[15] [15] In another embodiment, the invention provides a therapeutic composition comprising the synthetic RNA molecule described herein.
[16] [16] In another aspect, the invention provides a therapeutic composition comprising a synthetic RNA molecule that encodes a gene editing protein and a transfection reagent.
[17] [17] In another embodiment, the invention provides a method for transfecting a cell with a nucleic acid comprising contacting the cell with the synthetic RNA molecule described herein.
[18] [18] In another embodiment, the invention provides a method for inducing a mammalian cell to express a protein of interest comprising contacting the cell with the synthetic RNA molecule described herein. In another embodiment, the invention provides a method for reprogramming a cell comprising contacting the cell with the synthetic RNA molecule described herein. In another embodiment, the invention provides a method for editing a cell's gene comprising contacting the cell with the synthetic RNA molecule described herein.
[19] [19] In another aspect, the invention provides a method for transfecting a cell with a nucleic acid comprising: contacting the cell with a medium containing hydrocortisone and / or albumin, in which the albumin is treated with an ion exchange resin or carbon, and contacting the cell with the nucleic acid. In one embodiment, albumin is treated with a short-chain fatty acid, and / or brought to a temperature of at least 40 ° C.
[20] [20] In another aspect, the invention provides a medium comprising albumin, in which the albumin is recombinant and treated with an ion exchange resin or carbon. In another embodiment, the medium further comprises a buffered saline solution and amino acids and / or one or more of insulin, transferrin and selenium and / or cholesterol and / or a steroid (such as, for example, hydrocortisone) and / or an immunosuppressant (such as , for example, B18R).
[21] [21] In another aspect, the invention provides a kit comprising hydrocortisone and / or albumin, in which the albumin is treated with an ion exchange resin or carbon and a synthetic RNA molecule. In one embodiment, the synthetic RNA molecule encodes at least one of: Oct4 protein, Sox2 protein, Klf4 protein, c-Myc protein, Nanog protein, Lin28 protein and Utfl protein. In another embodiment, the kit further comprises a transfection reagent and / or the synthetic RNA molecule described herein. In another embodiment, the kit is a reprogramming kit and / or a gene editing kit.
[22] [22] In another aspect, the invention provides a nucleic acid transfection reagent complex comprising a nucleic acid and a transfection reagent, wherein the nucleic acid transfection reagent complex is solidified by cooling. In some embodiments, the nucleic acid transfection reagent complex is solidified by contacting the nucleic acid transfection reagent complex with liquid nitrogen in the liquid and / or vapor phase.
[23] [23] In another aspect, the invention provides a method for transfecting a cell comprising contacting the cell with the nucleic acid transfection reagent complex described herein.
[24] [24] In another aspect, the invention provides a system for transfecting cells comprising a means for contacting the cells with a transfection medium and a means for contacting the cells with a nucleic acid transfection reagent complex. In some embodiments, the atmosphere around the cells contains approximately 5% carbon dioxide and / or approximately 5% oxygen.
[25] [25] In some embodiments, the invention provides a cell and / or an organism and / or a therapeutic composition and / or a therapeutic composition comprising a cell produced by the methods described herein.
[26] [26] In some respects, synthetic RNA molecules with low toxicity and high translation efficiency are provided. In other respects, methods, kits and devices for producing and releasing synthetic RNA molecules to cells are provided. In yet other aspects, a cell culture medium for transfection, reprogramming and gene editing of highly efficient cells is provided. Other aspects relate to drugs that comprise synthetic RNA molecules, including for the treatment of type 1 diabetes, heart disease, including ischemic and dilated cardiomyopathy, macular degeneration, Parkinson's disease, cystic fibrosis, sickle cell anemia, thalassemia, Fanconi anemia, severe combined immunodeficiency, hereditary sensory neuropathy, xeroderma pigmentosum, Huntington's disease, muscular dystrophy, amyotrophic lateral sclerosis, Alzheimer's disease, cancer and infectious diseases, including hepatitis and HIV / AIDS. Other aspects relate to drugs that comprise cells, including for the treatment of type 1 diabetes, heart disease, including ischemic and dilated cardiomyopathy, macular degeneration, Parkinson's disease, cystic fibrosis, sickle cell anemia, thalassemia, Fanconi anemia, severe combined immunodeficiency , hereditary sensory neuropathy, xeroderma pigmentosum, Huntington's disease, muscular dystrophy, amyotrophic lateral sclerosis, Alzheimer's disease, cancer and infectious diseases, including hepatitis and HIV / AIDS. DETAILED DESCRIPTION OF THE FIGURES
[27] [27] The present invention is illustrated by way of example and not by way of limitation, in the figures in the accompanying drawings and in which:
[28] [28] FIG. 1 shows RNA encoding the indicated proteins, resolved on a denaturing agarose-formaldehyde gel.
[29] [29] FIG. 2A shows primary human fibroblasts, transfected with synthetic RNA encoding Oct4 and comprising the indicated nucleotides. "A" refers to adenosine, "G" refers to guanosine, "U" refers to uridine, "C" refers to cytidine, "psU" refers to pseudouridine, "5mC" refers to 5-methylcytidine, “N4mC” refers to N4-methylcytidine, “7dG” refers to 7-
[30] [30] FIG. 2B shows the expression of Oct4 and cell density of cultures of primary human fibroblasts, transfected with synthetic RNA encoding Oct4 and comprising the indicated nucleotides. Nucleotides are abbreviated as in FIG. 2A, except that "7dA" refers to 7-deazaadenosine, and "piC" refers to pseudoisocytidine. Cell density is shown normalized for non-transfected cells. Oct4 expression is shown normalized to synthetic RNA containing only canonical nucleotides. The error bars indicate the standard error (n = 3).
[31] [31] FIG. 3A shows a reprogrammed cell line generated by primary human fibroblasts transfected with RNA encoding the proteins Oct4, Sox2, Klf4, c-Myc-2 (T58A) and Lin28, one day after the colonies were chosen and plated on a plate coated with basement membrane extract.
[32] [32] FIG. 3B shows a reprogrammed cell line, generated as in FIG. 3A, stained for the pluripotent stem cell markers Oct4 and SSEA4. The panel marked “Hoechst” shows the cores, and the panel marked “Fusion” shows the fused signals from three channels.
[33] [33] FIG. 3C shows primary human fibroblasts, transfected and cultured as in FIG. 3A. A total of 5 transfections were performed. The photos were taken on the day
[34] [34] FIG. 4A shows a 1.5mm diameter dermal biopsy tissue sample.
[35] [35] FIG. 4B shows a tissue sample, collected as in FIG. 4A and suspended at the air-liquid interface of a solution containing an enzyme.
[36] [36] FIG. 4C shows primary human fibroblasts, collected as in FIG. 4A, dissociated as in FIG. 4B and plated in a well of a 96-well plate.
[37] [37] FIG. 5A shows primary human fibroblasts, reprogrammed for insulin-producing cells. The cells were fixed and stained for insulin.
[38] [38] FIG. 5B shows primary human fibroblasts, reprogrammed for hematopoietic cells. The cells were fixed and stained for CD34.
[39] [39] FIG. 5C shows primary human fibroblasts, reprogrammed for striking heart cells.
[40] [40] FIG. 6A shows the direct strand in an in vitro transcription model for the production of a TALEN ™ RNA structure.
[41] [41] FIG. 6B shows the model of FIG. 6A after a Golden Gate cloning reaction to incorporate a series of monomer repeats, forming a complete TALEN ™ RNA model.
[42] [42] FIG. 6C shows a TALEN ™ RNA with 5'-cap, 3'-poly (A) tail produced from the model of FIG. 6B.
[43] [43] FIG. 7 shows the sequence of the model of FIG. 6B, where the TALEN ™ RNA is designed to bind to a 20bp region of DNA, and where the regions marked “X (02) X”, “X (03) X”, and so on, represent the repeating variable domains (RVDs) that can be selected to target a specific DNA sequence. This model encodes a TALEN ™ RNA, where the first residue bound by the TALEN ™ RNA is a thymidine residue, independently of the RVDs, and so the first RVD is marked with “X (02) X” instead of “X (01 ) X ”.
[44] [44] FIG. 8 shows primary human fibroblasts, edited by gene and reprogrammed. The arrows indicate the colonies of cells with a reprogrammed morphology.
[45] [45] FIG. 9A shows the front view of a system that can transfect and / or reprogram cells automatically or semi-automatically.
[46] [46] FIG. 9B shows the rear panel of the system of FIG. 9A.
[47] [47] FIG. 9C shows the main components of the system of FIG. 9A.
[48] [48] FIG. 10A shows the complexation of RNA and a transfection reagent within a complexation medium.
[49] [49] FIG. 10B shows two methods for providing pre-complexed pellets containing nucleic acids.
[50] [50] FIG. 10C shows a method for removing the cover from a well plate using suction.
[51] [51] FIG. 10D shows a method for removing the cover from a well plate using a handle.
[52] [52] FIG. 11 shows a system that can transfect and / or reprogram cells automatically or semi-automatically in an operable combination with equipment for imaging, incubation, and another way to manipulate the cells. Definitions
[53] [53] By "molecule" means a molecular entity (molecule, ion, complex, etc.).
[54] [54] By "protein" means a polypeptide.
[55] [55] By "RNA molecule" means a molecule that comprises RNA.
[56] [56] By "synthetic RNA molecule" means an RNA molecule that is produced outside a cell or that is produced inside a cell using bioengineering, for example, an RNA molecule that is produced in an in vitro transcription reaction , an RNA molecule that is produced by direct chemical synthesis or an RNA molecule that is produced in a genetically modified E. coli cell.
[57] [57] By "nucleotide" means a nucleotide or a fragment or derivative thereof, for example, a nucleobase, a nucleoside, a triphosphate nucleotide, etc.
[58] [58] By "nucleoside" means a nucleotide.
[59] [59] By "transfection" means contacting a cell with a molecule, where the molecule is internalized by the cell.
[60] [60] By "after transfection" means during or after transfection.
[61] [61] By "transfection reagent" means a substance or mixture of substances that associates with a molecule and facilitates the release of the molecule for and / or internalization of the molecule by a cell, for example, a cationic lipid, a charged polymer or a peptide that penetrates the cell.
[62] [62] By "reagent based transfection" means transfection using a transfection reagent.
[63] [63] By "cell culture medium" means a medium that can be used for cell culture, for example, Dulbecco's Modified Eagle Medium (DMEM) or DMEM + 10% fetal bovine serum (FBS).
[64] [64] By "complexation medium" means a medium to which a transfection reagent and a molecule to be transfected are added and in which the transfection reagent associates with the transfected molecule.
[65] [65] By "transfection medium" means a medium that can be used for transfection, for example, Dulbecco's Modified Eagle Medium (DMEM) or DMEM / F12.
[66] [66] By "recombinant protein" means a protein or peptide that is not produced in animals or humans. Non-limiting examples include human transferrin that is produced in bacteria, human fibronectin that is produced in an in vitro culture of mouse cells, and human serum albumin that is produced in a rice plant.
[67] [67] By "lipid carrier" means a substance that can increase the solubility of a lipid or lipid-soluble molecule in aqueous solution, for example, human serum albumin or methyl-beta-cyclodextrin.
[68] [68] "Oct4 protein" means a protein that is encoded by the POU5F1 gene, or a natural or engineered variant, family member, orthologist, fragment or fusion construct thereof, for example, human Oct4 protein (SEQ ID NO: l), mouse Oct4 protein, Oct1 protein, a protein encoded by the POU5F1 pseudogene 2, an DNA binding domain of the Oct4 protein or an Oct4-GFP fusion protein. In some embodiments, the Oct4 protein comprises an amino acid sequence that has at least 70% identity with SEQ ID NO: 1, or in other embodiments, at least 75%, 80%, 85%, 90% or 95% identity with SEQ ID NO: l. In some embodiments, the Oct4 protein comprises an amino acid sequence with 1 to 20 amino acid insertions, deletions or substitutions (collectively) in relation to SEQ ID NO: l. In other embodiments, the Oct4 protein comprises an amino acid sequence of 1 to 15 or 1 to 10 amino acid insertions, deletions or substitutions (collectively) in relation to SEQ ID NO: 1.
[69] [69] By "Sox2 protein" means a protein that is encoded by the SOX2 gene, or a natural or engineered variant, family member, orthologist, fragment or fusion construct thereof, for example, human Sox2 protein (SEQ ID NO: 2), mouse Sox2 proteins, a DNA binding domain of the Sox2 protein or a Sox2-GFP fusion protein. In some embodiments, the Sox2 protein comprises an amino acid sequence that has at least 70% identity with SEQ ID NO: 2, or in other embodiments, at least 75%, 80%, 85%, 90% or 95% identity with SEQ ID NO: 2. In some embodiments, the Sox2 protein comprises an amino acid sequence with 1 to 20 amino acid insertions, deletions or substitutions (collectively) in relation to SEQ ID NO: 2. In other embodiments, the Sox2 protein comprises an amino acid sequence with 1 to 15 or 1 to 10 amino acid insertions, deletions or substitutions (collectively) in relation to SEQ ID NO: 2.
[70] [70] By "Klf4 protein" means a protein that is encoded by the KLF4 gene, or a natural or engineered variant, family member, orthologist, fragment or fusion construct thereof, for example, human Klf4 protein (SEQ ID NO: 3), mouse Klf4 protein, a DNA binding domain of the Klf4 protein or a Klf4-GFP fusion protein In some embodiments, the Klf4 protein comprises an amino acid sequence that has at least 70% identity with SEQ ID NO: 3, or in other modalities, at least 75%, 80%, 85%, 90% or 95% identity with SEQ ID NO: 3. In some embodiments, the Klf4 protein comprises an amino acid sequence with from 1 to 20 amino acid insertions, deletions or substitutions (collectively) in relation to SEQ ID NO: 3. In other embodiments, the Klf4 protein comprises an amino acid sequence with 1 to 15 or 1 to 10 amino acid insertions, deletions or substitutions (collectively) in relation to SEQ ID NO: 3.
[71] [71] By "c-Myc protein" means a protein that is encoded by the MYC gene, or a natural or engineered variant, family member, orthologist, fragment or fusion construct thereof, for example, human c-Myc protein ( SEQ ID NO: 4), mouse c-Myc protein, 1-Myc protein, c-Myc protein (T58A), a DNA binding domain of the c-Myc protein or a c-Myc-GFP fusion protein. In some embodiments, the c-Myc protein comprises an amino acid sequence that has at least 70% identity with SEQ ID NO: 4, or in other embodiments, at least 75%, 80%, 85%, 90% or 95% identity with SEQ ID NO: 4. In some embodiments, the c-Myc protein comprises an amino acid sequence with from 1 to 20 amino acid insertions, deletions or substitutions (collectively) in relation to SEQ ID NO: 4. In other embodiments, the c-Myc protein comprises an amino acid sequence of 1 to 15 or 1 to 10 amino acid insertions, deletions or substitutions (collectively) in relation to SEQ ID NO: 4.
[72] [72] By "reprogramming" means causing a change in a cell's phenotype, for example, causing a β cell parent to differentiate into a mature β cell, causing a fibroblast to de-differentiate into a pluripotent stem cell, causing a keratinocyte to transdifferentiate into a cardiac stem cell or causing a neuron's axon to grow.
[73] [73] By "reprogramming factor" means a molecule that, when a cell is contacted with the molecule and / or the cell expresses the molecule, can, alone or in combination with other molecules, cause reprogramming, for example, Oct4 protein.
[74] [74] By "feeder" means a cell that can be used to condition the medium or otherwise support the growth of other cells in culture.
[75] [75] By "conditioning" means to contact one or more feeders with a medium.
[76] [76] By "fatty acid" means a molecule that comprises an aliphatic chain of at least two carbon atoms, for example, linoleic acid, alpha-linolenic acid, octanoic acid, a leukotriene, a prostaglandin, cholesterol, a glucocorticoid, a resolvin, a protectin, a thromboxane, a lipoxin, a maresin, a sphingolipid, tryptophan, N-acetyl tryptophan or a salt, methyl ester or derivatives thereof.
[77] [77] By "short-chain fatty acid" means a fatty acid that comprises an aliphatic chain of between two and 30 carbon atoms.
[78] [78] By "albumin" means a protein that is highly soluble in water, for example, human serum albumin.
[79] [79] By "associated molecule" means a molecule that is not covalently linked to another molecule.
[80] [80] By "albumin-associated molecule component" means one or more molecules that are linked to an albumin polypeptide, for example, lipids, hormones, cholesterol, calcium ions, etc., which are linked to an albumin polypeptide .
[81] [81] By "treated albumin" means albumin that is treated to reduce, remove, otherwise inactivate the associated molecule component of albumin, for example, human serum albumin that is incubated at an elevated temperature, human serum albumin which is contacted with sodium octanoate or human serum albumin which is contacted with a porous material.
[82] [82] By "ion exchange resin" means a material that, when contacted with a solution containing ions, can replace one or more of the ions with one or more different ions, for example, a material that can replace one or more ions of calcium by one or more sodium ions.
[83] [83] By "germ cells" means a sperm or an egg.
[84] [84] By "pluripotent stem cells" means a cell that can differentiate into cells from all three germ layers (endoderm, mesoderm and ectoderm) in vivo.
[85] [85] By "somatic cells" means a cell that is not a pluripotent stem cell or a germ cell, for example, a skin cell.
[86] [86] By "glucose-responsive insulin-producing cell" means a cell that, when exposed to a certain glucose concentration, can produce and / or secrete an amount of insulin that is different (or less or more than) the amount insulin that the cell produces and / or secretes when the cell is exposed to a different concentration of glucose, for example, a β cell.
[87] [87] By "hematopoietic cell" means a blood cell or a cell that can differentiate into a blood cell, for example, a hematopoietic stem cell or a white blood cell.
[88] [88] By "cardiac cell" means a heart cell or a cell that can differentiate into a heart cell, for example, a cardiac stem cell or a cardiomyocyte.
[89] [89] By "retinal cell" means a retinal cell or a cell that can differentiate into a retinal cell, for example, a pigmented retinal epithelial cell.
[90] [90] By "skin cell" means a cell that is normally found on the skin, for example, a fibroblast, a keratinocyte, a melanocyte, an adipocyte,
[91] [91] By "Wnt signaling agonist" means a molecule that can perform one or more of the biological functions of one or more members of the Wnt family of proteins, for example, Wntl, Wnt2, Wnt3, Wnt3a or 2-amino-4- [3,4- (methylenedioxy) benzylamino] -6- (3-methoxyphenyl) pyrimidine.
[92] [92] By "agonist IL-6 signaling" means a molecule that can perform one or more of the biological functions of the IL-6 protein, for example, IL-6 protein or IL-6 receptor (also known as IL-6 receptor soluble, IL-6R, IL-6R alpha, etc.).
[93] [93] "TGF-β signaling agonist" means a molecule that can perform one or more of the biological functions of one or more members of the TGF-β superfamily of proteins, for example, TGF-β1, TGF-β3, activin A, BMP-4 or Nodal.
[94] [94] By "immunosuppressant" means a substance that can suppress one or more aspects of an immune system, and which is not normally present in a mammal, for example, B18R or dexamethasone.
[95] [95] By "gene editing" means changing the DNA sequence of a cell.
[96] [96] By "gene editing protein" means a protein that can, alone or in combination with another molecule, alter the DNA sequence of a cell, for example, a nuclease, a transcriptional activator-like nuclease (TALEN) , a zinc finger nuclease, a meganuclease, a nickase or a natural or projected variant, family member, orthologist, fragment or fusion construct thereof.
[97] [97] By "single strand break" means a region of single stranded or double stranded DNA in which one or more of the covalent bonds that link the nucleotides is broken into one or two strands.
[98] [98] By "double strand break" means a region of double stranded DNA in which one or more of the covalent bonds that link the nucleotides is broken into each of the two strands.
[99] [99] Serum albumin is a common component of serum-free cell culture medium. It has now been discovered that serum albumin can inhibit transfection, and that including untreated serum albumin in a transfection medium at concentrations normally used in serum free cell culture media can result in low transfection efficiency and / or viability low cell after transfection. The serum albumin polypeptide can bind to a wide variety of molecules, including lipids, ions, cholesterol, etc., in vitro and in vivo, and, as a result, serum albumin that is isolated from blood and serum albumin recombinant cells comprise a polypeptide component and an associated molecule component. It has now been found that low transfection efficiency and low cell viability after transfection caused by serum albumin may be caused in part by the associated molecule component of serum albumin. It has also been found that transfection efficiency can be increased and the toxicity associated with transfection can be reduced by partially or completely reducing, removing, replacing or otherwise inactivating the associated component of the serum albumin molecule. Certain embodiments of the invention, therefore, are directed to a method for treating a protein to partially or completely reduce, remove, replace or otherwise inactivate the associated protein molecule component. Other modalities are directed at a protein that is treated to partially or completely reduce, remove, replace or otherwise inactivate the associated protein molecule component.
[100] [100] Certain modalities are directed to a method for treating a protein by contacting the protein with one or more molecules that reduce low transfection efficiency and / or low cell viability after transfection caused by the protein. Contacting serum albumin with short-chain fatty acids, sodium octanoate (also known as “octanoic acid”, “octanoate”, “caprylate” or “caprylic acid”) has been shown to reduce the low transfection efficiency and low cell viability after transfection caused by serum albumin in certain situations. Other substances that can be used to treat a protein include: capric acid, lauric acid, myristic acid, palmitic acid, stearic acid, arachidic acid, behenic acid, lignoceric acid, cerotic acid, myristoleic acid, palmitoleic acid, saphenic acid, oleic acid , elaidic acid, vaccenic acid, linoleic acid, linoelaidic acid, alpha-linolenic acid, arachidonic acid, eicosapentaenoic acid, erucic acid, docosahexaenoic acid, tryptophan, N-acetyl tryptophan, cholesterol, other fatty acids, salts, mixtures and fragments and derivatives of the same. Substances to treat a protein can be pure substances, well-defined mixtures or complex or undefined mixtures, such as oils of animal or vegetable origin, for example, cod liver oil. In certain embodiments, a protein is treated after the protein is purified. In other embodiments, a protein is treated before the protein is purified. In yet other embodiments, a protein is treated at the same time as the protein is purified. In yet other embodiments, a protein is treated, and the protein is not purified.
[101] [101] Incubating a protein at an elevated temperature can cause partial or complete denaturation of the polypeptide component of the protein, which can reduce or eliminate binding sites that may be instrumental in maintaining the associated protein molecule component. Certain modalities, therefore, are directed towards a method for treating a protein by incubating the protein at an elevated temperature. In one embodiment, the protein is incubated at a temperature of at least about 40 ° C for at least about 10 minutes. In another embodiment, the protein is incubated at a temperature of at least about 50 ° C for at least about 10 minutes. In another embodiment, the protein is incubated at a temperature of at least about 55 ° C for at least about 30 minutes. In one embodiment, the protein is contacted with sodium octanoate and then incubated at about 60 ° C for several hours, such as between about 1 hour and 24 hours, or about 2 hours and about 6 hours. In another embodiment, the concentration of sodium octanoate is between about 5mM and about 50mM, or between about 10mM and about 40mM. In certain embodiments, sodium octanoate is replaced by or used in combination with at least one element of capric acid, lauric acid, myristic acid, palmitic acid, stearic acid, arachidic acid, beenic acid, lignoceric acid, cerotic acid, myristoleic acid , palmitoleic acid, sapienic acid, oleic acid, elaidic acid, vaccenic acid, linoleic acid, linoelaidic acid, alpha-linolenic acid, arachidonic acid, eicosapentaenoic acid, erucic acid, docosahexaenoic acid, tryptophan, N-acetyl tryptophan and cholesterol or a salt , mixture, fragment, and derivatives thereof.
[102] [102] Glycation and glycosylation are processes by which one or more sugar molecules are linked to a protein. Glycation and glycosylation can affect the binding properties of a protein and serum albumin contains several potential glycation sites. Certain modalities are therefore directed to a method for treating a protein by glycating or glycosylating the protein.
[103] [103] Ion exchange resins, including anion exchange, cation exchange and mixed bed resins, are routinely used to deionize solutions. The associated protein molecule component such as serum albumin can comprise ions. Certain modalities, therefore, are directed towards a method for treating a protein by contacting the protein with one or more ion exchange resins. In one embodiment, the one or more ion exchange resin includes a mixed bed resin containing functional groups with proton (H +) and hydroxyl (OH-) forms. In another embodiment, the one or more ion exchange resins include an indicator that changes color when the resin becomes saturated with ions. In addition to contacting one or more ion exchange resins, other methods can be used to reduce, remove, replace or otherwise inactivate the associated molecule component of a protein, including contacting the protein with charcoal, which can be activated and / or treated with a chemical such as dextran sulfate, dialysis (including dilution resulting from the association of the associated molecule component, the associated molecules being or not subsequently removed from the solution), crystallization, chromatography, electrophoresis, heat treatment, low temperature treatment, high pH treatment, low pH treatment, precipitation in organic solvent and affinity purification.
[104] [104] Certain methods for treating a protein may preferentially reduce, remove, replace or otherwise inactivate specific types of molecules. In certain situations, therefore, it may be beneficial to combine two or more methods to treat a protein to reduce low transfection efficiency and / or low cell viability after transfection caused by the protein. Certain modalities, therefore, are directed to a method for treating a protein using two or more methods to reduce, remove, replace or otherwise inactivate the associated protein molecule component. In one embodiment, a protein is contacted with one or more ion exchange resins and activated carbon. In another embodiment, a protein is contacted with sodium octanoate, incubated at an elevated temperature, contacted with one or more ion exchange resins and contacted with activated carbon. In another embodiment, the protein is serum albumin, and the elevated temperature is at least about 50 ° C.
[105] [105] Certain elements of the associated molecule component of a protein may be beneficial for cells in culture, and / or for transfection, for example, certain resolvins, protectins, lipoxins, maresins, eicosanoids, prostacyclins, thromboxanes, leukotrienes, cyclopentenone prostaglandins and glucocorticoids. Certain modalities, therefore, are directed towards a method for treating a protein to reduce, remove, replace or otherwise inactivate the associated protein molecule component without reducing, removing, replacing or otherwise inactivating one or more beneficial elements of the associated protein molecule component. Other modalities are directed to a method for treating a protein to reduce, remove, replace or otherwise inactivate the associated molecule component of the protein and still contact the protein with one or more molecules comprising one or more beneficial elements of the associated molecule component. of the protein.
[106] [106] Still other modalities are directed to a method for treating a protein to reduce low transfection efficiency and / or low cell viability after transfection caused by the protein by contacting the protein with one or more molecules comprising one or more beneficial elements of the associated component. of protein molecule.
[107] [107] Adding transferrin to the complexation medium has been reported to increase the efficiency of plasmid transfection in certain situations. It has now been discovered that adding transferrin to the complexation medium can also increase the efficiency of transfection with synthetic RNA molecules. Certain modalities are therefore directed to a method for inducing a cell to express a protein of interest by adding one or more synthetic RNA molecules and a transfection reagent to a transferrin-containing solution. In one embodiment, transferrin is present in the solution at a concentration of between about 1 mg / L and about 100 mg / L, such as about 5 mg / L. In another embodiment, transferrin is recombinant.
[108] [108] Other embodiments are directed to a medium that contains a protein that is treated according to one or more of the methods of the present invention. In certain embodiments, the protein is treated before being mixed with one or more of the other ingredients in the medium. In one embodiment, the medium is a transfection medium. In another modality, the medium also supports efficient transfection and high cell viability. In certain embodiments, the protein and one or more molecules that reduce low transfection efficiency and / or low cell viability after transfection caused by the protein are added regardless of the medium. In one embodiment, the protein is treated before being mixed with one or more of the other ingredients in the medium. In another embodiment, the medium is prepared by first treating a concentrated solution of serum albumin by contacting the concentrated solution of serum albumin with one or more ion exchange resins, then removing one or more ion exchange resins from the concentrated solution. of serum albumin, and then adding the treated concentrated solution of serum albumin to the other components of the medium. In another embodiment, the concentrated serum albumin solution is further contacted with charcoal before adding the concentrated serum albumin solution to the other components of the medium. In yet another embodiment, the concentrated serum albumin solution is first contacted with sodium octanoate, then raised to a temperature of at least about 50 ° C for at least 10 minutes, then contacted with one or more exchange resins ionic, then contacted with activated carbon and then added to the other components of the medium.
[109] [109] It has now been discovered that transfecting cells using a medium containing a buffered saline solution, amino acids, cholesterol, hydrocortisone and serum albumin can result in efficient transfection and that transfecting cells using a medium consisting essentially of a buffered saline solution, amino acids , insulin, transferrin, cholesterol, hydrocortisone, serum albumin, and a fibroblast growth factor can result in efficient transfection and efficient reprogramming. Certain modalities, therefore, are directed to a transfection medium containing: a buffered saline solution, amino acids, cholesterol, hydrocortisone and serum albumin.
[110] [110] In certain situations, it may be desirable to replace components of animal origin with components of non-animal origin and / or recombinant components, in part because components of non-animal origin and / or recombinant components can be produced with a greater degree of consistency of than components of animal origin, and partly because components of non-animal origin and / or recombinant components carry less risk of contamination with toxic and / or pathogenic substances than components of animal origin. Certain modalities, therefore, target a protein that is non-animal and / or recombinant. Other modalities are directed to a medium, in which some or all of the components of the medium are of non-animal and / or recombinant origin. In one embodiment, the protein is recombinant serum albumin. In another embodiment, the protein is recombinant human serum albumin. In yet another embodiment, the protein is recombinant serum albumin and all components of the medium are of non-animal and / or recombinant origin.
[111] [111] The N-terminal of serum albumin may contain a nickel and copper binding domain, which can be an important antigenic determinant. The deletion of the aspartic acid residue from the N-terminal of serum albumin can eliminate the binding activity of nickel and copper from serum albumin and may result in a hypoallergenic variant of the protein. Certain modalities, therefore, target a protein that has modified binding characteristics and / or other desirable characteristics, such as hypoallergenicity. In one embodiment, the protein is serum albumin, and serum albumin does not have an N-terminal aspartic acid.
[112] [112] Other modalities are directed to a method for transfecting a cell. In one embodiment, a cell is transfected with one or more nucleic acids and the transfection is performed using a transfection reagent, such as a lipid-based transfection reagent. In one embodiment, the one or more nucleic acids includes at least one RNA molecule. In another embodiment, the cell is transfected with one or more nucleic acids, and the one or more nucleic acids encodes at least one of: p53, TERT, a cytokine, a secreted protein, a membrane-bound protein, an enzyme, a protein gene editing software, a chromatin-modifying protein, a DNA-binding protein, a transcription factor, a histone deacetylase, a molecular pattern associated with a pathogen and a tumor-associated antigen or a biologically active fragment, analog, variant or family member. In another embodiment, the cell is transfected repeatedly, such as at least about 2 times for about 10 consecutive days, or at least about 3 times for about 7 consecutive days or at least about 4 times for about 6 consecutive days .
[113] [113] Reprogramming can be performed by transfecting cells with one or more nucleic acids that encode one or more reprogramming factors and culturing the cells in a medium that supports the reprogrammed cells.
[114] [114] Importantly, infection of skin cells with viruses encoding Oct4, Sox2, Klf4 and c-Myc, combined with culturing the cells in a medium that supports the growth of cardiomyocytes, has been reported to cause reprogramming of the cells of skin for cardiomyocytes, without first reprogramming the skin cells for pluripotent stem cells (See Efs et al Nat Cell Biol. 2011; 13: 215-22, whose content is incorporated as a reference). In certain situations, for example, when generating a therapeutic drug, direct reprogramming (reprogramming from one somatic cell to another somatic cell without first reprogramming the somatic cells to a pluripotent stem cell, also known as "transdifferentiation") may be desirable, partly because culturing pluripotent stem cells can be time-consuming and expensive, the additional manipulation involved in establishing and characterizing a stable pluripotent stem cell line can lead to an increased risk of contamination, and the additional time in culture associated with the first producing pluripotent stem cells can lead to an increased risk of genomic instability and the acquisition of mutations, including point mutations, copy number variations and karyotypic anomalies. Certain modalities, therefore, are directed towards a method for reprogramming a somatic cell, in which the cell is reprogrammed into a somatic cell, and in which a characterized pluripotent stem cell line is not produced.
[115] [115] Previously reported methods for reprogramming cells by transfecting them with RNA encoding reprogramming factors require the use of feeders. In many situations, the use of feeders may not be desirable, in part because the feeders may be derived from animal or allogeneic sources and thus may lead to risks of immunogenicity and contamination with pathogens. It has now been discovered that the medium of the present invention can activate reprogramming of RNA without feeders. It has also been discovered that reprogramming cells according to the methods of the present invention, in which the cells are not contacted with feeders, can be fast, efficient and reliable. Certain modalities, therefore, are directed towards a method for reprogramming a cell, in which the cell is not contacted with feeders.
[116] [116] It has now been discovered that reprogramming efficiency can correlate with initial cell density when cells are reprogrammed according to the methods of the present invention. Certain modalities, therefore, are directed towards a method for reprogramming the cells, in which the cells are plated at a density of between about 100 cells / cm2 and about
[117] [117] It has also been found that, in certain situations, less total transfections may be necessary to reprogram a cell according to the methods of the present invention than according to other methods. Certain modalities, therefore, are directed towards a method for reprogramming a cell, in which between about 2 and about 12 transfections are performed for about 20 consecutive days, or between about 4 and about 10 transfections are performed for about 15 consecutive days, or between about 4 and about 8 transfections are performed for about 10 consecutive days. It is recognized that when nucleic acids are added to a medium in which a cell is grown, the cell is likely to come into contact with and / or internalize more than one nucleic acid molecule simultaneously or at different times. A cell can therefore be contacted with a nucleic acid more than once, for example, repeatedly, even when nucleic acids are added only once to a medium in which the cell is cultured.
[118] [118] Feeders can promote cell adhesion to a surface by secreting molecules such as collagen that bind to the surface ("cell adhesion molecules"). Proteins, including integrins, on the surface of cells can bind to these cell adhesion molecules, which can result in cells sticking to the surface. It has now been discovered that cells can be reprogrammed, including without feeders, by coating a surface with one or more cell adhesion molecules. It has also been discovered that the cell adhesion molecules fibronectin and vitronectin are particularly suitable for this purpose. Certain modalities, therefore, are directed towards a method for transfecting, reprogramming, and / or editing a cell's gene, in which the cell is contacted with a surface that is contacted with one or more cell adhesion molecules. In one embodiment, the one or more cell adhesion molecules include at least one of: poly-L-lysine, poly-L-ornithine, RGD peptide, fibronectin, vitronectin, collagen and laminin, or a biologically active fragment, analog, variant or a member of their family. In another embodiment, the one or more cell adhesion molecules are fibronectin or a biologically active fragment thereof. In another embodiment, fibronectin is recombinant. In yet another embodiment, the one or more cell adhesion molecules are a mixture of fibronectin and vitronectin or a biologically active fragment thereof. In another embodiment, fibronectin and vitronectin are present in a concentration of about 100ng / cm2 on the surface and / or in a concentration of about 1ug / mL in a solution used to coat the surface. In yet another embodiment, fibronectin and vitronectin are recombinant. The contact of the surface with one or more cell adhesion molecules can be carried out as an independent step, and / or including one or more cell adhesion molecules in the medium.
[119] [119] Of note, nucleic acids can contain one or more non-canonical, or “modified” residues (for example, a residue other than adenine, guanine, thymine, uracil and cytosine or the standard nucleosides, nucleotides, deoxynucleosides or deoxynucleotides derived of the same). Of particular note, pseudouridine-5'-triphosphate can be replaced by uridine-5'-triphosphate in an in vitro transcription reaction to produce synthetic RNA, in which up to 100% of the uridine residues in the synthetic RNA can be replaced by residues of pseudouridine. In vitro transcription can produce RNA with residual immunogenicity, even when pseudouridine and 5-methylcytidine are completely replaced by uridine and cytidine, respectively (See Angel Reprogramming Human Somatic Cells to Pluripotency Using RNA [Doctoral Thesis]. Cambridge, MA: MIT; 2011 , whose contents are hereby incorporated by reference). For this reason, it is common to add an immunosuppressant to the transfection medium when transfecting cells with RNA. In certain situations, the addition of an immunosuppressant to the transfection medium may not be desirable, in part because the recombinant immunosuppressant most commonly used for this purpose, B18R,
[120] [120] Reprogrammed cells produced according to certain modalities of the present invention are suitable for therapeutic applications, including transplantation for patients, since they do not contain exogenous DNA sequences, and are not exposed to products of animal or human origin, which it may be undefined, and it may contain toxic and / or pathogenic contaminants. In addition, the high speed, efficiency and reliability of certain embodiments of the present invention can reduce the risk of acquiring and accumulating mutations and other chromosomal abnormalities. Certain embodiments of the present invention, therefore, can be used to generate cells that have an appropriate safety profile for use in therapeutic applications. For example, reprogramming cells using RNA and the medium of the present invention, where the medium does not contain components of animal or human origin, can produce cells that have not been exposed to allogeneic material. Certain modalities are therefore directed to a reprogrammed cell that has a desirable safety profile. In one embodiment, the reprogrammed cells have a normal karyotype. In another embodiment, reprogrammed cells have less than about 5 copy number variations (CNVs) in relation to the patient's genome, as well as less than about 3 copy number variations in relation to the patient's genome, or no variation of copy number in relation to the patient's genome. In yet another embodiment, the reprogrammed cell has a normal karyotype and less than about 100 unique nucleotide variants in the coding regions in relation to the patient's genome, or less than about 50 unique nucleotide variants in the coding regions in relation to the patient's genome or less than about 10 unique nucleotide variants in the coding regions relative to the patient's genome.
[121] [121] Endotoxins and nucleases can co-purify and / or become associated with other proteins, such as serum albumin. Recombinant proteins, in particular,
[122] [122] In certain situations, protein-based lipid carriers such as serum albumin can be replaced with non-protein-based lipid carriers such as methyl beta-cyclodextrin. The medium of the present invention can also be used without a lipid carrier, for example, when transfection is performed using a method that cannot require or cannot benefit from the presence of a lipid carrier, for example, using one or more polymer-based transfection reagents or peptide-based transfection reagents.
[123] [123] Many molecules associated with proteins, such as metals, can be highly toxic to cells. This toxicity can cause decreased viability in the culture, as well as the acquisition of mutations. Certain modalities, therefore, have the added advantage of producing cells that are free of toxic molecules.
[124] [124] The associated molecule component of a protein can be measured by suspending the protein in solution and measuring the conductivity of the solution. Certain modalities, therefore, target a medium that contains a protein, in which about 10% of the protein solution in water has a conductivity of less than about 500 µmho / cm. In one embodiment, the solution has a conductivity of less than about 50 µmho / cm.
[125] [125] A low oxygen environment can be beneficial for culturing many types of cells. Certain modalities, therefore, are directed to a method of cultivation, transfection, reprogramming and / or gene editing cells, in which cells are cultured, transfected, reprogrammed, and / or edited with a gene in a low oxygen environment. In one embodiment, the low oxygen environment contains between about 2% and about 10% oxygen, or between about 4% and about 6% oxygen.
[126] [126] The amount of nucleic acid released to cells can be increased to increase the desired effect of the nucleic acid. However, increasing the amount of nucleic acid released to cells beyond a certain point can cause a decrease in cell viability, due in part to the toxicity of the transfection reagent. It has now been found that when a nucleic acid is released to a population of cells in a fixed volume (for example,
[127] [127] It has now been found that modulating the amount of nucleic acid released to a population of proliferating cells in a series of transfections can result in increased nucleic acid effect and increased cell viability.
[128] [128] Certain modalities are directed to a method for transfecting a cell with a nucleic acid, in which the amount of nucleic acid is determined by measuring cell density, and choosing the amount of nucleic acid to transfect based on the measurement of cell density. In one embodiment, the cell is present in an in vitro culture, and cell density is measured by optical means. In another embodiment, the cell is transfected repeatedly, the cell density increases between two transfections and the amount of nucleic acid transfected is greater for the second of the two transfections than for the first of the two transfections.
[129] [129] It has now been found that, in certain situations, the efficiency of transfection and the viability of cells cultured in the medium of the present invention can be improved by conditioning the medium. Certain modalities, therefore, are directed towards a method to condition the environment. Other modalities are directed to a medium that is conditioned. In one embodiment, the feeders are fibroblasts, and the medium is conditioned for approximately 24 hours. Other modalities are directed to a method for transfecting a cell, in which the transfection medium is conditioned. Other modalities are directed to a method to reprogram and / or edit a cell with a gene, in which the medium is conditioned. In one embodiment, feeders are mitotically inactivated, for example, by exposure to a chemical substance such as mitomycin-C, or by exposure to gamma radiation. In certain embodiments, it may be beneficial to use only autologous materials, partly, for example, and not wishing to be bound by theory, to avoid the risk of disease transmission from the feeders to the cell. Certain modalities, therefore, are directed towards a method for transfecting a cell, in which the transfection medium is conditioned, and in which the feeders are derived from the same individual as the cell being transfected. Other modalities are directed to a method to reprogram and / or edit a cell with a gene, in which the medium is conditioned, and in which the feeders are derived from the same individual of the cell being reprogrammed and / or edited into a gene.
[130] [130] Various molecules can be added to the medium by conditioning. Certain modalities, therefore, are directed to a medium that is complemented with one or more molecules that are present in a conditioned medium. In one embodiment, the medium is complemented with Wntl, Wnt2, Wnt3, Wnt3a or a biologically active fragment, analogue, variant, agonist or member of their family. In another modality, the medium is complemented with TGF-β or a biologically active fragment, analogue, variant, agonist or member of the same family. In yet another embodiment, a cell is reprogrammed according to the method of the present invention, in which the medium is not supplemented with TGF-β for between about 1 and about 5 days and then is supplemented with TGF-β for less than about 2 days. In yet another modality, the medium is complemented with IL-6, IL-6R or a biologically active fragment, analogue, variant, agonist or member of their family. In yet another modality, the medium is supplemented with a sphingolipid or a fatty acid. In yet another modality, the sphingolipid is lysophosphatidic acid, lysophingomyelin, sphingosine-1-phosphate or a biologically active analog, variant or derivative thereof.
[131] [131] In addition to mitotically inactivating cells, under certain conditions, irradiation can alter the gene expression of cells, causing cells to produce less of certain proteins and more of other proteins than non-irradiated cells, for example, members of the Wnt family of proteins. In addition, certain members of the Wnt family of proteins can promote cell growth and transformation. It has now been found that, in certain situations, the efficiency of RNA reprogramming can be greatly increased by contacting the cell with a medium that is conditioned using irradiated feeders instead of feeders treated with mitomycin-c. It has also been found that the increase in reprogramming efficiency observed when using irradiated feeders is caused in part by Wnt proteins that are secreted by the feeders. Certain modalities, therefore, are directed towards a method for reprogramming a cell, in which the cell is in contact with Wntl, Wnt2, Wnt3, Wnt3a or a biologically active fragment, analog, variant, family member or agonist thereof, including agonists downstream targets of Wnt proteins, and / or agents that mimic one or more of the biological effects of Wnt proteins, for example 2-amino-4- [3,4- (methylenedioxy) benzylamino] -6- (3-methoxyphenyl ) pyrimidine.
[132] [132] It has now been found that the medium of the present invention can be used to maintain cells, including fibroblasts and human pluripotent stem cells, in culture (i.e., as a "maintenance medium"). Certain modalities are therefore directed to a medium that is used as a means of maintenance. In one embodiment, the medium does not contain any components of human origin. In another embodiment, the medium is chemically defined.
[133] [133] Due to the low efficiency of many DNA-based reprogramming methods, these methods may be difficult or impossible to use with cells derived from patient samples, which may contain only a small number of cells.
[134] [134] It has now been found that, in certain situations, transfecting cells with a mixture of RNA encoding Oct4, Sox2, Klf4 and c-Myc using the medium of the present invention can cause an increased rate of cell proliferation. When the amount of RNA released to cells is too low to guarantee that all cells are transfected, only a fraction of the cells can show an increased proliferation rate. In certain situations, such as when generating a personalized drug, increasing the rate of cell proliferation may be desirable, in part because it can reduce the time needed to generate the drug and therefore can reduce the cost of the drug. Certain modalities, therefore, are directed towards a method for transfecting a cell with a mixture of RNA that encodes Oct4, Sox2, Klf4 and c-Myc, in which the cell has an increased proliferation rate. In one embodiment, cells that show an increased rate of cell proliferation are isolated from the culture. In another embodiment, cells that show an increased proliferation rate are expanded and cultured in a medium that supports the growth of one or more cell types and are reprogrammed into a cell of one of one or more cell types.
[135] [135] Many diseases are associated with one or more mutations. Mutations can be corrected by contacting a cell with a nucleic acid that encodes a protein that, alone or in combination with other molecules, corrects the mutation (an example of gene editing). Examples of these proteins include: zinc finger nucleases and TALENs. Certain modalities, therefore, are directed towards a method for transfecting a cell with a nucleic acid, in which the nucleic acid encodes a protein that, alone or in combination with other molecules, creates a single-stranded or double-stranded break in a molecule of DNA. In one embodiment, the protein is a zinc finger nuclease or TALEN. In another embodiment, the nucleic acid is an RNA molecule. In yet another modality, the single-stranded or double-stranded break is within about 5,000,000 bases of the transcription start site of a gene selected from the group: CCR5, CXCR4, GAD1, GAD2, CFTR, HBA1, HBA2, HBB , HBD, FANCA, XPA, XPB, XPC, ERCC2, POLH, HTT, DMD, SOD1, APOE, PRNP, BRCA1, and BRCA2 or an analog, variant or family member thereof. In another embodiment, the cell is transfected with a nucleic acid that acts as a repair model, causing the insertion of a DNA sequence in the region of the single strand or double strand break,
[136] [136] Genes that can be edited according to the methods of the present invention to produce drugs of the present invention include genes that can be edited to restore normal function, as well as genes that can be edited to reduce or eliminate function. These genes include, but are not limited to, beta globin (HBB), mutations that can cause sickle cell disease (SCD) and β-thalassemia, breast cancer 1, early onset (BRCA1) and breast cancer 2, early onset (BRCA2), mutations in which they can increase susceptibility to breast cancer, CC chemokine receptor type 5 (CCR5) and CXC chemokine receptor type 4 (CXCR4), mutations that can confer resistance to HIV infection, cystic fibrosis transmembrane conductance regulator (CFTR), mutations that can cause cystic fibrosis, dystrophin (DMD), mutations that can cause muscular dystrophy, including Duchenne muscular dystrophy and Becker muscular dystrophy, glutamate decarboxylase 1 and glutamate decarboxylase 2 (GADl, GAD2), mutations that can prevent destruction autoimmune β cells, alpha hemoglobin 1, alpha hemoglobin 2 and delta hemoglobin (HBA1, HBA2 and HBD), mutations that can cause thalassemia, Huntington (HTT), mutations in which they can cause Huntington's disease, superoxide dismutase 1 (SOD1), mutations that can cause amyotrophic lateral sclerosis (ALS), XPA, XPB, XPC, XPD (ERCC6) and polymerase (directed DNA), eta (POLH), mutations that can cause xeroderma pigmentosum, repetitions rich in leucine kinase 2 (LRRK2), mutations that can cause Parkinson's disease and Fanconi's anemia, complementation groups A, B, C, Dl, D2, E, F, G, I, J, L, M, N, P ( FANCA, FANCB, FANCC, FANCD1, FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ, FANCL, FANCM, FANCN, FANCP) and RAD51 counterpart C (S. cerevisiae) (RAD51C), mutations that can cause Fanconi's anemia.
[137] [137] Certain embodiments target a drug comprising a nucleic acid that encodes one or more gene editing proteins. Other embodiments are directed to a medicament comprising one or more cells that are transfected, reprogrammed, and / or edited with a gene according to the methods of the present invention. In one embodiment, a cell is transfected, reprogrammed, and / or edited into a gene, and the transfected cell, reprogrammed, and / or edited into a gene is introduced into a patient. In another embodiment, the cell is collected from the same patient in whom the transfected, reprogrammed and / or edited gene is introduced. Examples of diseases that can be treated with medicaments of the present invention include, but are not limited to, Alzheimer's disease, spinal cord injury, amyotrophic lateral sclerosis, cystic fibrosis, heart disease, including ischemic and dilated cardiomyopathy, macular degeneration, Parkinson's disease, Huntington's disease , diabetes, sickle cell anemia, thalassemia, Fanconi anemia, xeroderma pigmentosum, muscular dystrophy, severe combined immunodeficiency, hereditary sensory neuropathy, cancer and HIV / AIDS. In certain embodiments, the drug comprises a cosmetic. In one embodiment, a cell is collected from a patient, the cell is reprogrammed and expanded to a large number of fat cells, thereby producing a cosmetic, and the cosmetic is introduced into the patient. In yet another modality, the cosmetic is used for tissue reconstruction.
[138] [138] While detailed examples are provided here for the production of specific types of cells and for the production of drugs comprising specific types of cells, it is recognized that the methods of the present invention can be used to produce many other types of cells and to produce medicaments comprising one or more of the many other types of cells, for example, reprogramming a cell according to the methods of the present invention, and culturing the cell under conditions that mimic one or more aspects of development providing conditions that resemble the present conditions in the cellular microenvironment during development.
[139] [139] Certain modalities target a cell library with a variety of human leukocyte antigen (HLA) types ("combined HLA libraries"). A combined HLA library can be beneficial in part because it can provide rapid production and / or distribution of drugs without the patient having to wait for a drug to be produced from the patient's cells. This library can be particularly beneficial for the treatment of heart disease and blood disorders and / or the immune system for which patients can benefit from the immediate availability of a drug.
[140] [140] Certain modalities target a cell that is used for tissue / organ modeling and / or disease modeling. In one embodiment, a skin cell is reprogrammed and expanded to a large number of cardiac cells, and cardiac cells are used to screen bioactive molecules for cardiotoxicity (an example of a safety test). In another embodiment, a skin cell in a patient with Alzheimer's disease is reprogrammed and expanded to a large number of cortical neurons, and cortical neurons are used to screen bioactive molecules to reduce the accumulation of insoluble plaques (a test example effectiveness). Certain embodiments of the present invention are, therefore, useful for safety tests and / or effectiveness tests.
[141] [141] Certain modalities are directed towards a method for encapsulating cells and / or for propagating cells in a structure and for cells that are encapsulated and / or cells that are propagated in a structure. In certain situations, encapsulating cells can be beneficial, in part because encapsulated cells may be less immunogenic than non-encapsulated cells. In one embodiment, a cell is reprogrammed into a glucose-responsive insulin-producing cell, the glucose-responsive insulin-producing cell is encapsulated in a material such as alginate, and the encapsulated glucose-responsive insulin-producing cell is introduced into a patient with type 1 diabetes. In another modality, the introduction is by intraperitoneal injection or intraportal injection. In certain situations, the propagation of cells in a structure can be beneficial, in part because a structure can provide mechanical stability. In one embodiment, a cell is reprogrammed and expanded into a large number of fibroblasts and keratinocytes, the fibroblasts and keratinocytes are propagated in a structure comprising collagen, and the propagated structure is applied to a wound, forming a synthetic skin graft. In another embodiment, a cell is reprogrammed, the reprogrammed cell is mixed with a structure in the form of a liquid or paste, the mixture is introduced into the patient and the rigidity of the structure increases with or after introduction.
[142] [142] Certain modalities address a method for purifying cells. Transfecting, reprogramming and gene editing can often produce populations of cells that include cells with the desired phenotype and cells with one or more undesirable phenotypes. Certain modalities, therefore, are directed towards a method for purifying transfected, reprogrammed, and / or edited cells with a gene. In one embodiment, the cells are purified using a density gradient. In another embodiment, the cells are purified by contacting the cells with one or more antibodies that allow separation of the cells with one or more desired phenotypes from cells with one or more undesirable phenotypes. In another embodiment, the antibody is bound to a substrate, preferably a magnetic granule. In yet another embodiment, the antibody is attached to a fluorescent molecule, and separation is performed by fluorescence-activated cell classification (FACS) or other similar means. In another embodiment, cells with an undesirable phenotype are prevented from proliferating, preferably by contacting cells with one or more molecules that prevent cells from dividing, preferably mitomycin-c, 5-aza-deoxycytidine, fluorouracil or a biologically active or derived analog. of the same. Other modalities are directed to a drug comprising cells that are purified to enrich the fraction of cells with one or more desired phenotypes.
[143] [143] Certain modalities are directed towards a method for producing animal models, including models of mutations and diseases. In one embodiment, an animal skin cell is edited into a gene and reprogrammed into a pluripotent stem cell. In another embodiment, about 1-100 cells reprogrammed and edited with a gene are injected into a blastocyst and the blastocyst is implanted in the uterine horn of an animal. In one modality, the animal is selected from the group: a cat, a dog, a mouse, a pig, a horse, a cow, a chicken, a sheep, a goat, a fish, a primate and a mouse. In another embodiment, the animal is a rat.
[144] [144] Certain non-canonical nucleotides, when incorporated into synthetic RNA molecules, can reduce the toxicity of synthetic RNA molecules, in part by interfering with the binding of proteins that detect exogenous nucleic acids, for example, protein kinase R, Rig -1 and the oligoadenylate synthase protein family. Non-canonical nucleotides that have been reported to reduce the toxicity of synthetic RNA molecules when incorporated include: pseudouridine, 5-methyluridine, 2-thiouridine, 5-methylcytidine, N6-methyladenosine, and certain combinations thereof. However, the chemical characteristics of the non-canonical nucleotides that can enable them to reduce the toxicity of synthetic RNA molecules, up to this point, have remained unknown. In addition, the incorporation of large amounts of most non-canonical nucleotides, for example, 5-methyluridine, 2-thiouridine, 5-methylcytidine and N6-methyladenosine, can reduce the efficiency with which synthetic RNA molecules can be translated into proteins , limiting the usefulness of synthetic RNA molecules containing these nucleotides in applications that require protein expression. Furthermore, while pseudouridine can be completely replaced by uridine in synthetic RNA molecules without reducing the efficiency with which synthetic RNA molecules can be translated into proteins, in certain situations, for example, when performing frequent, repeated transfections, RNA molecules synthetic containing only adenosine, guanosine, cytidine and pseudouridine may present excessive toxicity.
[145] [145] It has now been discovered that synthetic RNA molecules containing one or more non-canonical nucleotides that include one or more substitutions at positions 2C and / or 4C and / or 5C in the case of a pyrimidine or positions 6C and / or 7N and / or 8 C in the case of a purine may be less toxic than synthetic RNA molecules containing only canonical nucleotides, due in part to the ability of substitutions at these positions to interfere with the recognition of synthetic RNA molecules by proteins that detect acids exogenous nucleic acids, and furthermore, these substitutions at these positions can have a minimal impact on the efficiency with which synthetic RNA molecules can be translated into protein, due in part to the lack of interference from substitutions at these positions with base and base stacking.
[146] [146] Examples of non-canonical nucleotides that include one or more substitutions at positions 2C and / or 4C and / or 5C in the case of a pyrimidine or positions 6C and / or 7N and / or 8C in the case of a purine include, among others : 2- thiouridine, 5-azauridine, pseudouridine, 4-thiouridine, 5-
[147] [147] Nucleotides that contain the prefix "amino" can refer to any nucleotide that contains a nitrogen atom attached to the atom at the indicated position of the nucleotide, for example, 5-aminocytidine can refer to 5-aminocytidine, methylaminocytidine-5 and 5-nitrocitidine. Likewise, nucleotides that contain the prefix "methyl" can refer to any nucleotide that contains a carbon atom attached to the atom at the indicated position of the nucleotide, for example, 5-methylcitidine can refer to 5-methylcitidine, 5-ethylcytidine and 5-hydroxymethylcitidine, nucleotides that contain the prefix “uncle” can refer to any nucleotide that contains a sulfur atom attached to the atom at the given position in the nucleotide, and nucleotides that contain the prefix “hydroxy” can refer to any nucleotide that contains an oxygen atom attached to the atom at the determined position of the nucleotide.
[148] [148] Certain modalities, therefore, target a synthetic RNA molecule, where the synthetic RNA molecule contains one or more nucleotides that includes one or more substitutions at the 2C and / or positions
[149] [149] Certain non-canonical nucleotides can be incorporated more efficiently than other non-canonical nucleotides into synthetic RNA molecules by RNA polymerase that is commonly used for in vitro transcription, due in part to the tendency of these certain non-canonical nucleotides to participate in interactions of standard base pairing and base stacking interactions and interacting with RNA polymerase in a similar way in which the corresponding canonical nucleotide interacts with RNA polymerase.
[150] [150] It has now been found that combining certain non-canonical nucleotides can be beneficial in part because the contribution of non-canonical nucleotides to reducing the toxicity of synthetic RNA molecules can be additive. Certain modalities are therefore directed to a nucleotide mixture, where the nucleotide mixture contains more than one of the non-canonical nucleotides listed above, for example, the nucleotide mixture contains pseudoisocitidine and 7-deazaguanosine or the nucleotide mixture contains N4 -methylcitidine and 7- deazaguanosine, etc. In one embodiment, the nucleotide mixture contains more than one of the non-canonical nucleotides listed above and each of the non-canonical nucleotides is present in the mixture in the fraction listed above, for example, the nucleotide mixture contains 0.1–0.8 pseudoisocytidine and 0.2–1.0 7-deazaguanosine or the nucleotide mixture contains 0.2–1.0 N4-methylcytidine and 0.2–1.0 7- deazaguanosine.
[151] [151] In certain situations, for example, when it may not be necessary or desirable to maximize the yield of an in vitro transcription reaction, nucleotide fractions other than those mentioned above can be used. The exemplary fractions and fraction ranges listed above refer to triphosphate nucleotide solutions of typical purity (more than 90% purity). Larger fractions of these and other nucleotides can be used by means of higher purity triphosphate nucleotide solutions, for example, greater than about 95% purity or greater than about 98% purity or greater than about 99% purity or greater than about 99.5% purity, which can be achieved, for example, by purifying the nucleotide triphosphate solution using existing chemical purification technologies such as high pressure liquid chromatography (HPLC) or by other means. In one embodiment, nucleotides with various isomers are purified to enrich the desired isomer.
[152] [152] Other modalities are directed to a method for inducing a cell to express a protein of interest by contacting the cell with a synthetic RNA molecule that contains one or more non-canonical nucleotides that includes one or more substitutions at the 2C and / or 4C positions and / or 5C in the case of a pyrimidine or the 6C and / or 7N and / or 8C positions in the case of a purine. Still other modalities are directed to a method for transfecting, reprogramming and / or gene-editing a cell by contacting the cell with a synthetic RNA molecule that contains one or more non-canonical nucleotides that includes one or more substitutions in the 2C and / or 4C positions and / or 5C in the case of a pyrimidine or the 6C and / or 7N and / or 8C positions in the case of a purine. In one embodiment, the synthetic RNA molecule is produced by in vitro transcription. In one embodiment, the synthetic RNA molecule encodes one or more reprogramming factors. In another embodiment, the one or more reprogramming factors include Oct4 proteins. In another embodiment, the cell is also contacted with a synthetic RNA molecule that encodes the Sox2 protein. In yet another modality, the cell is also contacted with a molecule of
[153] [153] Enzymes such as T7 RNA polymerase can preferably incorporate canonical nucleotides in an in vitro transcription reaction that contains canonical and non-canonical nucleotides. As a result, an in vitro transcription reaction that contains a certain fraction of the non-canonical nucleotide can produce RNA that contains a different, often lower, fraction of the non-canonical nucleotide than the fraction in which the non-canonical nucleotide was present in the reaction. In certain embodiments, references to nucleotide incorporation fractions (for example, “a synthetic RNA molecule containing 50% pseudoisocytidine” or “0.1-0.8 pseudoisocytidine”), therefore, can refer to RNA molecules that contain the indicated fraction of the nucleotide, and the RNA molecules synthesized in a reaction containing the indicated fraction of the nucleotide (or nucleotide derivative, for example, of the nucleotide-triphosphate), even though that reaction may produce RNA that contains a different fraction of the nucleotide than the fraction in which the non-canonical nucleotide was present in the reaction.
[154] [154] Different nucleotide sequences can encode the same protein using alternative codons. In certain embodiments, references to nucleotide incorporation fractions, therefore, may refer to RNA molecules that contain the indicated fraction of the nucleotide, and to RNA molecules that encode the same protein as a different RNA molecule, in which the molecule of different RNA contains the indicated fraction of the nucleotide.
[155] [155] Certain modalities are directed to a kit containing one or more materials necessary for the practice of the present invention. In one embodiment, the kit contains a synthetic RNA molecule. In one embodiment, the kit contains a synthetic RNA molecule that encodes one or more reprogramming factors and / or gene editing proteins. In another embodiment, synthetic RNA molecules contain one or more non-canonical nucleotides that include one or more substitutions at positions 2C and / or 4C and / or 5C in the case of a pyrimidine or positions 6C and / or 7N and / or 8C in the case of a purine. In another embodiment, the kit contains one or more of: a transfection medium, a transfection reagent, a complexing medium and a coating solution. In one embodiment, the coating solution contains fibronectin and vitronectin, preferably recombinant fibronectin and / or recombinant vitronectin. In one embodiment, one or more of the kit components are present as a plurality of rates. In one embodiment, the kit contains aliquots of nucleic acid transfection reagent complex. In another embodiment, the kit contains aliquots of nucleic acid transfection reagent complexes that are supplied in a solid form, for example, as frozen or lyophilized pellets. In yet another modality, the kit contains aliquots of the medium, in which each aliquot contains reagent-transfection nucleic acid which are stabilized by chemical treatment or by freezing.
[156] [156] Transfection, in general and reprogramming, in particular, can be difficult and time-consuming techniques that can be repetitive and error-prone. However, these techniques are often performed manually due to the lack of automated transfection equipment. Certain modalities are, therefore, directed to a system that can transfect, reprogram, and / or edit cells with genes automatically or semi-automatically.
[157] [157] Referring now to FIG. 9A through Fig. 11, certain modalities are directed to a system (1) capable of transfecting cells in a multi-well plate (2). In one embodiment, the plate is loaded on a tray (3) that slides out of the system. In another mode, the system is capable of storing several plates (12). In another embodiment, the system comprises a means (4) for storing a transfection medium. In one embodiment, the system comprises a means for storing the medium at a defined temperature, preferably between 2C and 6C. In one embodiment, the system comprises a means (5) for storing liquids, waste and / or cells taken from wells. In another embodiment, the system comprises a connection to supply energy (6). In yet another embodiment, the system comprises a port (33) for communicating with a computer (34). In one embodiment, the port is a USB port. In one embodiment, the system comprises an outlet fan (7). In another embodiment, the system comprises a connection for supplying a vacuum (8).
[158] [158] Cell viability can benefit from controlling the environment around cells. Certain modalities, therefore, are directed to a system comprising a means for incubating cells at a specific or desired temperature. In one embodiment, the cells are incubated at one or more temperatures that are between 35C and 39C. In one embodiment, the cells are incubated at a temperature of about 37 ° C. Other modalities are directed towards a system comprising a means to control the atmosphere in which the cells are incubated. In one embodiment, the system comprises a means of regulating the concentration of carbon dioxide in the atmosphere. In one embodiment, the concentration of carbon dioxide is between 3% and 7%, preferably about 5%. In another embodiment, the system comprises a means for regulating the oxygen concentration in the atmosphere. In one embodiment, the system regulates the oxygen concentration by introducing nitrogen. In yet another modality, the oxygen concentration is between 3% and about 7%, like about 5%. In one embodiment, the system comprises a means to control the concentrations of oxygen and carbon dioxide in the atmosphere in which the cells are incubated. In another embodiment, the system comprises a connection to supply carbon dioxide (9). In another embodiment, the system comprises a connection to supply nitrogen (10). In yet another modality, the system comprises a connection to supply oxygen (11).
[159] [159] Certain embodiments are directed to a system comprising a medium for dispersing nucleic acid transfection reagent complexes and / or medium (24). In one embodiment, the system comprises one or more pipettes loaded from the front that can dispense complexes and / or medium. Examples of other means for dispensing complexes include, but are not limited to: a back loaded pipette, a peristaltic pump, a microfluidic device, an electrospray nozzle, a piezoelectric ejector and an acoustic drop ejector. Certain modalities are directed to a system comprising a way to generate nucleic acid transfection reagent complexes (13). In one embodiment, the system comprises a means for combining one or more transfection reagents (14) and one or more nucleic acids (15). In one embodiment, the means for combining comprises one or more pipettes loaded from the front. Examples of other means that can be used to combine include, but are not limited to: a back loaded pipette, a peristaltic pump, a microfluidic device, an electrospray nozzle, a piezoelectric ejector and an acoustic drop ejector. In one embodiment, the system comprises one or more removable tips. In another embodiment, the one or more removable tips can be sterilized. In another embodiment, the one or more removable tips are disposable. In yet another embodiment, the one or more removable tips are made of plastic or glass. In yet another modality, the plastic is polypropylene. In one embodiment, the system comprises a means for incubating one or more nucleic acids with one or more transfection reagents in one or more complexing means (16). In another embodiment, the system comprises a means for storing one or more nucleic acids, one or more transfection reagents and one or more complexing means. In one embodiment, complexation occurs at room temperature. In one embodiment, the system comprises a means for heating the medium before contacting the cells with the medium, for example, between about 20 ° C and about 39 ° C, or between about 30 ° C and about 39 ° C. In one embodiment, the medium is heated using a heating element (25). In one embodiment, the system comprises a means for storing and / or dispensing multiple culture media.
[160] [160] Certain modalities are directed towards a method for storing nucleic acid transfection reagent complexes. In one embodiment, one or more nucleic acids and one or more transfection reagents are combined with one or more complexing media and are cooled to generate a nucleic acid transfection reagent pellet. In one embodiment, cooling is carried out by contacting with liquid nitrogen. Other cooling methods include, but are not limited to, contacting: a Peltier refrigerator, chilled liquid propane, chilled liquid ethane and a chilled polished metal surface. In one embodiment, the method is substantially free of RNase. Certain modalities are directed towards a method for transfecting cells using a nucleic acid transfection reagent pellet. In one embodiment, the pellet is heated before being added to the transfection medium. In one embodiment, the pellet is heated by placing the pellet in a small volume of hot transfection medium which is then contacted with the cells to be transfected. In another embodiment, the pellet is added directly to the transfection medium. Certain modalities are directed to a system that can perform transfection using nucleic acid transfection reagent pellets. In one embodiment, the system comprises a means for storing the pellets (17) within a defined temperature range. In one embodiment, the temperature range is between about -90 ° C and about 0 ° C, preferably between about -30 ° C and -4 ° C. In one embodiment, the system comprises a means for dispensing pellets. In one embodiment, pellets are dispensed using a plunger (19). In another embodiment, pellets are dispensed using a rotating disc (20) that contains an opening (21) through which the pellets are dispensed. In one embodiment, the apparatus comprises a means for heating the pellet before adding the pellet to the transfection medium. In one embodiment, the pellet is heated by placing the pellet in a small container (22) containing hot transfection medium which is then contacted with the cells to be transfected. In another embodiment, the device contains a means for dispensing the pellet directly to the transfection medium. In yet another modality, the pellets are stored in a cartridge (16). In one embodiment, the system comprises a means for replacing cartridges (36).
[161] [161] During cell culture, it may be beneficial to replace, in whole or in part, the culture medium to supplement the culture medium with an additional amount of medium or other complement to add nutrients and / or to reduce, remove or otherwise inactivate cell debris or other undesirable components that may be present in the medium, including residual complexes. Certain modalities, therefore, are directed to a system comprising a medium (23) for removing, in whole or in part, the culture medium from the cells. In one embodiment, the system comprises a vacuum cleaner.
[162] [162] Certain modalities are directed to a system comprising a means for removing the cover from a well plate. In one embodiment, the system comprises a means for removing the cover from a well plate (26) using suction (27). Other means for removing the cover from a well plate include, among others: an adhesive, an articulated appendix (28), tweezers, a magnet and an electromagnet. In certain embodiments, the system comprises a means for imaging the cells (29). In one embodiment, cell density is determined by measuring the optical density of the vial containing the cells. In another embodiment, cell density is determined by imaging the cells.
[163] [163] Certain modalities are directed to a system that is used in an operable combination with other equipment, for example, equipment for cultivation, imaging or other ways to manipulate cells. In one embodiment, the system (1) is loaded using a robotic arm (30). In another embodiment, a robotic arm is used to transfer plates from and / or to an incubator (31). In another embodiment, a plate imager (32) is used for imaging the cells. In yet another embodiment, the system is controlled using a computer (34). In one embodiment, the system is used to transfect, reprogram and / or edit the cells with a gene.
[164] [164] The present invention, therefore, aims to provide products for therapeutic and research use.
[165] [165] The details of the invention are set out in the description that accompanies below. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, illustrative materials and methods are now described. Other features, objects and advantages of the invention will be apparent from the description and the claims. In the specification and in the appended claims, singular forms also include the plural unless the context clearly determines differently. Unless otherwise stated, all scientific and technical terms used here have the same meaning as commonly understood by one of those skilled in the art to which this invention belongs.
[166] [166] The RNA encoding the human proteins Oct4, Sox2, Klf4, c-Myc-2 (T58A) and Lin28 and comprising various combinations of canonical and non-canonical nucleotides, was synthesized from DNA models (Table 1). RNA samples were analyzed by agarose gel electrophoresis to assess the quality of the RNA (FIG. 1). The RNA was then diluted to between 100ng / µL and 500ng / µL. For certain experiments, an RNase inhibitor (SuperaseIn ™, Life Technologies Corporation) was added to a concentration of 1µL / 100µg of RNA. RNA solutions were stored at 4C. For certain experiments involving mixtures of RNA, RNA encoding Oct4, Sox2, Klf4, c-Myc-2 (T58A), and Lin28 was mixed in a molar ratio of 3: 1: 1: 1: 1. Table 1.
[167] [167] “A” refers to adenosine-5'-triphosphate, “G” refers to guanosine-5'-triphosphate, “U” refers to uridine-5'-triphosphate, “C” refers to cytidine- 5'- triphosphate, “psU” refers to pseudouridine-5'-triphosphate, “5mC” refers to 5-methylcytidine-5'-triphosphate, “2sU” refers to 2-thiouridine-5'-triphosphate, “psisoC ”Refers to pseudoisocytidine-5'-triphosphate,“ 5mU ”refers to 5-methyluridine-5'-triphosphate,“ 7dA ”refers to 7-deazaadenosine-5'-triphosphate,“ 7dG ”refers to 7- deazaguanosine -5'-triphosphate, and "N4mC" refers to N4-methylcytidine-5'-triphosphate.
[168] [168] A medium has been developed to support efficient cell transfection, reprogramming and gene editing:
[169] [169] DMEM / F12 + 10 µg / mL insulin + 5.5 µg / mL transferrin + 6.7ng / mL sodium selenite + 20ng / mL bFGF + 5mg / mL treated human serum albumin.
[170] [170] Variants of this medium have also been developed to provide better performance when used with specific transfection reagents, specific nucleic acids and specific cell types: DMEM / F12 + 10µg / mL insulin + 5.5 µg / mL transferrin + 6.7ng / mL sodium selenite + 4.5µg / mL cholesterol + 20ng / mL bFGF + 5mg / mL treated human serum albumin, DMEM / F12 + 10µg / mL insulin + 5.5µg / mL transferrin + 6.7ng / mL selenite sodium + 1 µΜ hydrocortisone + 20ng / mL bFGF + 5mg / mL treated human serum albumin, and DMEM / F12 + 10µg / mL insulin + 5.5µg / mL transferrin + 6.7ng / mL sodium selenite + 4.5µg / mL cholesterol + 1 µΜ hydrocortisone + 20ng / mL bFGF + 5mg / mL treated human serum albumin.
[171] [171] Examples of additional components that were added to the cell culture medium in certain experiments (listed with example concentrations) include: 15mM HEPES, 2mM L-alanyl-L-glutamine, 2µg / ml ethanolamine, 10µg / ml fatty acids , 10 µg / mL cod liver oil fatty acids (methyl esters), 25 µg / mL polyoxyethylene sorbitan monooleate, 2 µg / mL D-alpha-tocopherol acetate, 1-50 µg / mL L-ascorbic acid 2-phosphate hydrate sesquimagnesio salt, 200ng / mL B18R, and 0.1% Pluronic F-68.
[172] [172] For certain experiments in which the medium was conditioned, the following variant was used:
[173] [173] DMEM / F12 + 15mM HEPES + 2mM L-alanyl-L-glutamine + 10µg / mL insulin + 5.5µg / mL transferrin + 6.7ng / mL sodium selenite + 2µg / mL ethanolamine + 4.5µg / mL cholesterol + 10µg / ml cod liver oil fatty acids (methyl esters) + 25µg / ml polyoxyethylene sorbitan monooleate + 2µg / ml D-alpha-tocopherol acetate + 1µg / ml L-ascorbic acid 2-phosphate salt hydrate sesquimagnésio + 0.1% Pluronic F-68 + 20ng / mL bFGF + 5mg / mL treated human serum albumin.
[174] [174] For certain experiments in which the medium was not conditioned, the following variant was used.
[175] [175] DMEM / F12 + 15mM HEPES + 2mM L-alanyl-L-glutamine + 10µg / mL insulin + 5.5µg / mL transferrin + 6.7ng / mL sodium selenite + 2µg / mL ethanolamine + 4.5µg / mL cholesterol + 1µΜ hydrocortisone + 0-25µg / ml polyoxyethylene sorbitan monooleate + 2µg / ml D-alpha-tocopherol acetate + 50µg / ml L-ascorbic acid 2-phosphate sesquimagnese salt hydrate + 20ng / ml bFGF + 5mg / ml albumin of treated human serum.
[176] [176] For the preparation of these variants, the treated human serum albumin was treated by adding 32mM sodium octanoate, followed by heating at 60C for 4h, followed by a treatment with ion exchange resin (AG501-X8 (D)) for 6 hours at room temperature, followed by treatment with dextran-coated activated carbon (C6241, Sigma-Aldrich Co. LLC.) overnight at room temperature, followed by centrifugation, filtration, adjustment to a 10% solution with water free of nuclease, followed by the addition of other components of the medium. For certain experiments in which the medium was conditioned, the medium was conditioned for 24h in irradiated human neonatal fibroblast feeders. The cells were plated on fibronectin-coated plates or fibronectin and vitronectin-coated plates, unless otherwise indicated.
[177] [177] The formulation of the medium can be adjusted to meet the needs of the specific cell types being grown.
[178] [178] For transfection in 6-well plates, 2µg RNA and 6µL transfection reagent ((Lipofectamine ™ RNAiMAX, Life Technologies Corporation) were first diluted separately in the complexing medium (Opti-MEM®, Life Technologies Corporation) to a total volume diluted RNA and transfection reagent were then mixed and incubated for 15 minutes at room temperature, according to instructions from the transfection reagent manufacturer. The complexes were then added to cells in culture. Between 30 µL and 240 µL of complexes were added to each well of a 6-well plate, which already contained 2mL of transfection medium per well. The plates were then gently shaken to distribute the complexes throughout the well. The cells were incubated with complexes for 2 hours overnight. , before replacing the medium with fresh transfection medium (2mL / well). The volumes were scaled for transfection in 24-well and 96-well plates. The cells were fixed and stained at 20-24h after transfection using an antibody against Oct4 (FIG. 2A). The nuclei were stained and counted to determine the relative toxicity of the RNA (FIG. 2B). Example 4 Analysis of the Capacity of Untreated Human Serum Albumin Preparations to Support Nucleic Acid Transfection and RNA Reprogramming
[179] [179] Primary human neonatal fibroblasts were cultured in medium with or without 5mg / mL HSA. Cohn fraction
[180] [180] A 10% HSA solution was preincubated with 22mM sodium chloride and 16mm sodium octanoate (Sigma-Aldrich Co. LLC) and was incubated at 37C for 3 hours before mounting the complete medium. Example 6 Treatment of Human Serum Albumin Using Ion Exchange Chromatography
[181] [181] A 20% solution of recombinant HSA produced in Pichia pastoris (A7736, Sigma-Aldrich Co. LLC.) Was prepared by dissolving 2g HSA in 10mL of nuclease-free water with slight agitation at room temperature. The HSA solution was then deionized first by adding 1g of mixed bed deionizing resin (AG 501-X8 (D), Bio-Rad Laboratories, Inc.), and stirring for 1 hour at room temperature. The HSA solution was then decanted into a tube containing 5g of fresh resin and was stirred for 4 hours at room temperature. Finally, the deionized HSA solution was decanted, adjusted to a total protein content of 10% with nuclease-free water, filter sterilized using a 0.2 µm PES filter membrane and stored at 4C.
[182] [182] Primary human neonatal fibroblasts were cultured in media containing recombinant HSA treated according to Example 4 or containing HSA derived from treated blood (Bio-Pure HSA, Biological Industries). The cells were transfected daily, according to Example 3, with RNA synthesized according to Example 1, starting on day 0. The photos were taken on day 3. Several small areas of cells undergoing morphological changes resembling the mesenchymal transition to epithelial cells were observed in wells containing octanoate, indicating an increased transfection efficiency. Many large areas of morphological changes resembling the mesenchymal to epithelial transition have been observed in samples containing HSA derived from treated blood. In both cases, the morphological changes were characteristic of reprogramming. Example 8 Reprogramming Human Fibroblasts Using Medium Containing Octanoate-Treated Human Serum Albumin
[183] [183] Primary human neonatal fibroblasts were plated in 6-well plates at a density of 5000 cells / well in the fibroblast medium (DMEM + 10% fetal bovine serum). After 6 hours, the medium was replaced with the transfection medium containing octanoate-treated HSA. The cells were transfected daily, according to Example 3, with RNA synthesized according to Example 1, starting on day 0. On day 5, the well contained several areas of cells showing morphology consistent with reprogramming. This experiment did not include the use of feeders or immunosuppressants.
[184] [184] Primary human neonatal fibroblasts were transfected according to Example 3, with RNA synthesized according to Example 1, starting on day 0. The photos were taken on day 2. The cells in the well containing untreated HSA showed low viability compared to the well containing HSA derived from treated blood or recombinant HSA treated with ion exchange resin. Example 10 Reprogramming Human Fibroblasts Using Human Serum Albumin Treated With Ion Exchange Resin
[185] [185] Primary human neonatal fibroblasts were plated in 6-well plates with feeders at a density of 10,000 cells / well in the fibroblast medium (DMEM + 10% fetal bovine serum). The cells were transfected daily, according to Example 3, with RNA synthesized according to Example 1, starting on the day
[186] [186] Primary human fibroblasts were plated in 6-well plates at a density of 20,000 cells / well in the fibroblast medium (DMEM + 10% fetal bovine serum). After 6 hours, the medium was replaced by the transfection medium containing treated HSA and not containing immunosuppressants, and the cells were transfected daily according to Example 3, with RNA synthesized according to Example 1, except that the dose of RNA was reduced to 1 µg / well and a total of 5 transfections were performed. The photos were taken on day 7. Small cell colonies showing consistent morphology with reprogramming became visible as early as day 5. On day 7, the medium was replaced with DMEM / F12 + 20% Knockout ™ Serum Replacement (Life Technologies Corporation) + 1X non-essential amino acids + 2mM L-glutamine, conditioned in embryonic mouse fibroblasts irradiated for 24 hours and then supplemented with 20ng / mL bFGF and 10µΜ Y-
[187] [187] A full-thickness dermal biopsy was performed on a healthy volunteer, 31 years old, according to an approved protocol. Briefly, an area of skin on the upper left arm was anesthetized by topical application of 2.5% lidocaine. The field was disinfected with 70% isopropanol, and a full-thickness dermal biopsy was performed using a diameter of 1.5 mm (FIG. 4A). The tissue was washed in phosphate-buffered saline (PBS) and placed in a 1.5mL tube containing 250µL of TrypLE ™ Select CTS ™ (Life Technologies Corporation), and incubated at 37C for 30min. The tissue was then transferred to a 1.5mL tube containing 250µL of DMEM / F12-CTS ™ (Life Technologies Corporation) + 5mg / mL collagenase and incubated at 37C for 2h (FIG. 4B). The epidermis was removed using forceps, and the tissue was mechanically dissociated. The cells were washed twice in DMEM / F12-CTS ™ and were plated in fibronectin coated wells of 24-well and 96-well plates. Phlebotomy was also performed on the same volunteer, and venous blood was collected in Vacutainer ® SST ™ tubes (Becton, Dickinson and Company). The serum was isolated according to the manufacturer's protocol. The isogenic plating medium was prepared by mixing DMEM / F12-CTS ™ + 2mM L-alanyl-L-glutamine (Sigma-Aldrich Co. LLC.) + 20% human serum. The cells of the skin tissue sample were plated in the transfection medium or isogenic plating medium. After 2 days, the wells were washed, and the medium was replaced with transfection medium. Many cells with a fibroblast morphology bound and began to spread by day 2 (FIG. 4C). The cells were transfected according to Example 3, with RNA synthesized according to Example 1, starting on day 2, with all volumes scaled to accommodate smaller wells. By day 5, areas of cells with morphologies consistent with reprogramming were observed. Example 13 Reprogramming Human Fibroblasts Using Synthetic RNA Containing Non-Canonical Nucleotides
[188] [188] Primary human fibroblasts were plated on 6-well plates coated with recombinant human fibronectin and recombinant human vitronectin (each diluted in DMEM / F12 at a concentration of 1µg / mL, 1mL / well, incubated at room temperature for 1h) a density of 20,000 cells / well in the transfection medium. On the following day, the cells were transfected as in Example 3, with RNA synthesized according to Example 1, except that the RNA dose was 0.5 µg / well on day 1,
[189] [189] Primary human fibroblasts were plated on 6-well plates coated with recombinant human fibronectin and recombinant human vitronectin (each diluted in DMEM / F12 at a concentration of 1µg / mL, 1mL / well, incubated at room temperature for 1h) in a density of 20,000 cells / well in the transfection medium. On the following day, the cells were transfected as in Example 3, with RNA synthesized according to Example 1, except that the dose of RNA was 0.5 µg / well on day 1, 0.5 µg / well on day 2, 2 µg / well on day 3, 2µg / well on day 4, and 4µg / well on day 5. Small colonies of cells presenting a morphology consistent with reprogramming became visible on day 5. On day 7, the medium was replaced with DMEM / F12 + 20% Knockout ™ Serum Replacement (Life Technologies Corporation) + 1X non-essential amino acids + 2mM L-glutamine, conditioned in embryonic mouse fibroblasts irradiated for 24 hours and then supplemented with 20ng / mL bFGF and 10µΜ Y-27632. Large colonies with a reprogrammed morphology became visible as early as day 8. Colonies were chosen on the day and plated in wells coated with basement membrane extract (Cultrex® Human BME Pathclear®, Trevigen Inc.). The cells grew rapidly and were passed to establish lines. Example 15 Generation of Glucose-Responsive Insulin-Producing Cells
[190] [190] The cells are reprogrammed according to Example 11 or Example 12, and are then grown in
[191] [191] The cells were reprogrammed according to Example 11 and then cultured in DMEM / F12, 100 ng / ml activin A, 25 ng / ml Wnt3a, 0.01% recombinant HSA, 1X ITSE for 1 day, followed by by DMEM / F12, 100 ng / ml activin A, 0.01% recombinant HSA, 1X ITSE for 2 days, followed by DMEM / F12, 50 ng / ml FGF10, 0.25 µΜ KAAD-cyclopamine, 0.01% HSA recombinant, 1X ITSE for 3 days, followed by DMEM / F12, 1% B27, 2 µΜ all-trans retinoic acid, 50 ng / ml FGF10, 0.25 µΜ KAAD-cyclopamine for 4 days, followed by DMEM / F12, 1 % B27, 1 µΜ γ-DAPT secretase inhibitor, 50 ng / ml exendin-4, 10 nM betacellulin, 10 mM nicotinamide for 2 days, followed by DMEM / F12, 50 mg / L ascorbic acid-2-phosphate, 1% B27 , 1 µΜ γ-DAPT secretase inhibitor, 50 ng / ml exendin-4, 50 ng / ml IGF-1, 50 ng / ml HGF, 10 nM betacellulin, 10 mM nicotinamide for 6 days to generate insulin-producing cells responsive to glucose (FIG. 5A). The resulting cells can be used in vitro or in vivo to screen bioactive molecules for the study of diabetes or for the development of diabetes drugs. Example 17 Personalized Cell Replacement Therapy for Type 1 Diabetes Understanding Reprogrammed Cells
[192] [192] The patient's skin cells are reprogrammed to glucose-responsive insulin-producing cells according to Example 12 and Example
[193] [193] RNA encoding TALENs with a 20bp combination was synthesized from DNA models as in Example 1 (FIG. 6A-C and Fig. 7) (Table 2). The resulting RNA was analyzed by agarose gel electrophoresis to assess the quality of the RNA. The RNA was then diluted to 200ng / µL and an RNase inhibitor (SuperaseTn ™, Life Technologies Corporation) was added to a concentration of 1µL / 100µg of RNA. RNA solutions were stored at 4C. The RNA encoding each half of the TALEN pair was mixed in a 1: 1 molar ratio.
[194] [194] Table 2.
[195] [195] The RNA that encodes TALENs L1: TCATTTTCCATACAGTCAGT, L2: TTTTCCATACAGTCAGTATC, R1: TGACTATCTTTAATGTCTGG, and R2: TATCTTTAATGTCTGGAAAT was synthesized according to Example 18. These TALENs target the b (L1 and L2) or antisense (R1 and R2). The following TALEN pairs were prepared: L1 & R1, L1 & R2, L2 & R1, and L2 & R2. Example 20 Gene Editing of the CCR5 Gene Using RNA TALENs and Free Reprogramming of DNA, Free of Feeder, Free of Immunosuppressant, Free of Conditioning of Human Fibroblasts
[196] [196] Primary human fibroblasts were plated on 6-well plates coated with recombinant human fibronectin and recombinant human vitronectin (each diluted in DMEM / F12 at a concentration of 1µg / mL, 1mL / well, incubated at room temperature for 1h) a density of 10,000 cells / well in the transfection medium. The next day, the cells were transfected as in Example 3, except that the RNA dose was 0.5 µg / well, and the RNA was synthesized according to Example 19. Beginning the next day, the cells were reprogrammed according to o Example 11. Large cell colonies with a reprogramming morphology feature became visible as in Example 11. The photos were taken on day 9 (FIG. 8). Example 21 Transfection of Cells with RNA TALENs and a DNA Repair Model
[197] [197] 0.5ug RNA + 0.5ug DNA containing the 1001bp region spanning from 500bp upstream of the target double strand break site to 500bp downstream of the target double strand break site and 6µL transfection reagent (Lipofectamine ™ 2000, Life Technologies Corporation) is first diluted separately in the complexing medium (Opti-MEM®), to a total volume of 60µL each. Diluted RNA + DNA and transfection reagent were then mixed and incubated for 15 minutes at room temperature, according to instructions from the transfection reagent manufacturer. The complexes were then added to cells in culture. Between 60µL and 120µL are added to each well of a 6-well plate, which already contained 2mL of transfection medium per well. The plates were then gently shaken to distribute the complexes throughout the well. The cells were incubated with complexes for 2 hours at night, before replacing the medium with fresh transfection medium (2mL / well). Example 22 Gene Editing Using TALEN RNA and a DNA Repair and DNA Free Reprogramming Model, Feeder Free, Immunosuppressant Free, Human Fibroblast Conditioning Free
[198] [198] Primary human fibroblasts are plated in 6-well plates at a density of 10,000 cells / well in the fibroblast medium (DMEM + 10% fetal bovine serum). After 6 hours, the medium is replaced with transfection medium containing treated HSA and not containing immunosuppressants, and the cells are transfected according to Example 21. Beginning the next day, the cells are reprogrammed according to Example 11 or Example 12 , except that the initial plating and media change steps are omitted. Example 23 Generation of Hematopoietic Cells
[199] [199] The cells were reprogrammed according to Example 11 and were then cultured in IMDM + 0.5% HSA + 1 x complement ITS + 450µΜ monothioglycerol + 2mM L-glutamine + 1X non-essential amino acids + 50ng / ml BMP4 + 50ng / mL VEGF + 50ng / mL bFGF for 6 days to generate hematopoietic cells (FIG. 5B). Alternatively, the cells are reprogrammed according to Example 11 or Example 12 or Example 20 or Example 22 and are then cultured in IMDM +
[200] [200] The patient's skin cells are reprogrammed to hematopoietic cells according to Example 23. The cells are then released from the culture flask, and between about 1 X 106 and about 1 X 107 cells / kg body weight of the patient are infused into a main vein over a period of several hours.
[201] [201] The patient's skin cells are edited with gene and reprogrammed to hematopoietic cells according to Example 23. The cells are then released enzymatically from the culture flask, and between about 1 X 106 and about 1 X 107 cells / kg of the patient's body weight are infused into a main vein over a period of several hours. Hematopoietic stem cells return to the bone marrow cavity and engraft. Alternatively, the patient's skin cells are edited with gene and reprogrammed to hematopoietic cells according to Example 23, the cells are then enzymatically released from the culture flask, and CD34 + / CD90 + / Lin- or CD34 + / CD49f + / Lin cells are isolated. Between about 1 X 103 and about 1 X 105 cells are infused into the patient's main vein. Hematopoietic stem cells return to the bone marrow cavity and engraft. Example 26 Models of Heart Disease for Screening Bioactive Molecules
[202] [202] The cells were reprogrammed according to Example 11 and then cultured in DMEM / F12 + 0.2% HSA + 0.5X complement N2 + 0.5X B27 complement + 100ng / mL activin A + 1µΜ wortmannin for 4 days, followed by 1: 1 F12 / IMDM + 0.5% HSA + 0.5% ITS complement + 0.5X B27 complement + 2µΜ retinoic acid + 20ng / mL FGF7 + 50ng / mL NOGGIN for 4 days, followed by DMEM / F12 + 1% complement ITS + 10ng / mL bFGF + 10mM nicotinamide + 50ng / mL exendin-4 + 10ng / mL BMP4 for 7-9 days to generate cardiac cells (FIG. 5C). Alternatively, the cells are reprogrammed according to Example 12. While cardiac cells can be isolated from other cells present in the culture, this method generates a sufficiently high percentage of cardiac cells that such isolation is generally not necessary. The resulting cells can be used in vitro or in vivo to screen bioactive molecules for the study of heart disease or for the development of drugs for heart disease. The resulting cells can also be used to screen for cardiotoxicity. Example 27 Personalized Cell Replacement Therapy for Ischemic Cardiomyopathy Comprising Reprogrammed Cells
[203] [203] The patient's skin cells are reprogrammed into cardiac cells according to Example 26. The cells are then enzymatically released from the culture flask and between about 1 X 106 and about 1 X 107 cells are injected into the pericardium or between about 1 X 103 and about 1 X 105 cells are injected into one or more coronary arteries. The cells graft, and additional injections are performed as needed. Example 28 Retinal Disease Models for Screening Bioactive Molecules
[204] [204] The cells are reprogrammed according to Example 11 or Example 12 and are then cultured in DMEM / F12 + 0.2% HSA + 0.5X N2 complement + 0.5X B27 complement 7 days to generate retinal cells. The resulting cells can be used in vitro or in vivo for screening bioactive molecules for the study of retinal disease or for the development of drugs for retinal disease. Example 29 Personalized Cell Replacement Therapy for Macular Degeneration Understanding Reprogrammed Cells
[205] [205] The patient's skin cells are reprogrammed to retinal cells according to the
[206] [206] Those skilled in the art will recognize, or be able to discover, using no more than the experimentation routine, numerous equivalents for the specific modalities specifically described here. These equivalents are intended to be included in the scope of the claims that follow. INCORPORATION AS A REFERENCE
[207] [207] All patents and publications cited here are incorporated herein by reference in their entirety.

权利要求:
Claims (25)
[1]
1. Method for reprogramming a cell to a less differentiated state, characterized by the fact that it comprises: (a) culture of a differentiated cell with a reprogramming medium containing albumin, in which the albumin is treated with an ion exchange resin or carbon ; (b) transfecting the cell with one or more synthetic RNA molecules, where the one or more synthetic RNA molecules includes at least one RNA molecule encoding one or more reprogramming factors and where the transfection results in the cell expressing the one or more reprogramming factors; and (c) repeating step (b) at least twice for consecutive days to result in the cell being reprogrammed to a less differentiated state.
[2]
2. Method, according to claim 1, characterized by the fact that the albumin was treated with sodium octanoate and / or was brought to a temperature of at least 40ºC.
[3]
3. Method according to claim 1 or 2, characterized by the fact that the one or more synthetic RNA molecules includes at least one RNA molecule encoding at least one member of the group: Oct4 protein, Sox2 protein, Klf4 protein and c-Myc protein.
[4]
4. Method according to claim 1 or 2, characterized by the fact that it still comprises contacting the cell with at least one member of the group: poly-L-lysine, poly-L-ornithine, RGD peptide, fibronectin, vitronectin, collagen and laminin.
[5]
Method according to claim 1 or 2, characterized in that the one or more synthetic RNA molecules contains at least one member of the group: a pseudouridine residue and a 5-methylcytidine residue.
[6]
6. Method according to claim 1 or 2, characterized by the fact that the cell is a skin cell.
[7]
7. Cell culture medium, characterized by the fact that it comprises: Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (DMEM / F12), 10µg / mL insulin, 5.5 µg / mL transferrin, 6.7ng / mL sodium selenite, 20ng / mL basic fibroblate growth factor (bFGF) and 5mg / mL albumin, in which the albumin is treated with an ion exchange resin and / or charcoal.
[8]
8. Cell culture medium according to claim 7, characterized by the fact that it still comprises at least one of: 15mM ethanesulfonic acid 4- (2-hydroxyethyl) -1-piperazine (HEPES), 2mM L-alanyl-L - glutamine, 2 µg / mL ethanolamine, 4.5 µg / mL cholesterol, 25 µg / mL polyoxyethylene sorbitan monooleate, 2 µg / mL D-alpha-tocopherol acetate, and 1 µg / mL L-ascorbic acid 2- phosphate sesquimagnésium salt hydrate .
[9]
9. Cell culture medium, according to claim 7, characterized by the fact that albumin is treated with sodium octanoate and / or is brought to a temperature of at least 40ºC.
[10]
10. Cell culture medium according to claim 7, characterized by the fact that albumin is recombinant.
[11]
11. Cell culture medium, characterized by the fact that it comprises: Dulbecco's Modified Eagle Medium: F-12 Nutrient Mix (DMEM / F12), 10µg / mL insulin, 5.5 µg / mL transferrin, 6.7ng / mL sodium selenite, 20ng / mL basic fibroblate growth factor (bFGF) and 5mg / mL albumin, where less than 0.65% of the dry weight of albumin comprises lipids and / or less than 0.35% of the dry weight of albumin comprises free fatty acids.
[12]
12. Cell culture medium according to claim 11, characterized by the fact that it still comprises at least one of: 15mM ethanesulfonic acid 4- (2-hydroxyethyl) -1-piperazine (HEPES), 2mM L-alanyl-L - glutamine, 2 µg / mL ethanolamine, 4.5 µg / mL cholesterol, 25 µg / mL polyoxyethylene sorbitan monooleate, 2 µg / mL D-alpha-tocopherol acetate, and 1 µg / mL L-ascorbic acid 2- phosphate sesquimagnésium salt hydrate .
[13]
13. Cell culture medium according to claim 11, characterized by the fact that albumin is recombinant.
[14]
14. Kit, characterized by the fact that it comprises the cell culture medium as defined in claim 7 or
10.
[15]
15. Kit according to claim 14, characterized by the fact that it still comprises one or more synthetic RNA molecules, wherein the one or more synthetic RNA molecules comprises at least one RNA molecule encoding one or more reprogramming factors .
[16]
16. Kit according to claim 15, characterized by the fact that the one or more synthetic RNA molecules comprises at least one RNA molecule encoding at least one of: Oct4 protein, Sox2 protein, Klf4 protein and c-Myc protein .
[17]
17. Kit according to claim 15, characterized in that the one or more synthetic RNA molecules comprises at least one of: a pseudouridine residue and a 5-methylcytidine residue.
[18]
18. Composition, characterized by the fact that it comprises a synthetic RNA molecule transcribed in vitro comprising at least one non-canonical nucleotide having a substitution in the 5C pyrimidine position and encoding a gene editing protein for translation into a mammalian cell, in which :
the non-canonical nucleotide having a substitution at the 5C position pyrimidine is selected from the group consisting of 5-methyluridine, 5-hydroxyuridine, pseudouridine, 5-methylpseudouridine, 5-hydroxyipseudouridine, 5-methylcytidine and 5-hydroxycydine and the editing protein gene is selected from the group consisting of a nuclease, a zinc finger nuclease, a meganuclease, a nickase, and a transcription activator effector nuclease (TALEN).
[19]
19. Composition, according to claim 18, characterized by the fact that the synthetic RNA molecule comprises at least two non-canonical nucleotides having a substitution in the 5C primidine position in which, the first non-canonical nucleotide is at least one of 5- methyluridine, 5-hydroxyuridine, pseudouridine, 5-methylpseudouridine and 5-hydroxipseudouridine, and the second non-canonical nucleotide is at least one of 5-methylcytidine and 5-hydroxycytidine.
[20]
20. Composition according to claim 18, characterized by the fact that the synthetic RNA comprises (a) at least one of pseudouridine, 5-methylpseudouridine, 5-hydroxipseudouridine and 5-hydroxyuridine at about 50% - 100% of the residues uridine or (b) 5-methyluridine to about 20% -60% of the uridine residues or (c) at least one of 5-methylcytidine and 5-hydroxycytidine to about 50% -100% of the cytidine residues.
[21]
21. Composition according to claim 18, characterized in that the synthetic RNA comprises at least three non-canonical nucleotides having a substitution in the 5C primidine position.
[22]
22. Composition according to claim 18, characterized by the fact that synthetic RNA improves the translation of the gene editing protein in a mammalian cell relative to a synthetic RNA molecule containing only canonical nucleotides and / or does not increase toxicity in the mammalian cell relative to a synthetic RNA molecule containing only canonical nucleotides.
[23]
23. Composition according to claim 18, characterized in that the synthetic RNA molecule still comprises one or more of a 5'-coat structure, a 5'-coat 1, and a 3'-poly (A ).
[24]
24. Composition according to claim 18, characterized in that the editing gene protein is capable of causing a double strand break.
[25]
25. Method for editing the gene of a biological cell, characterized by the fact that it comprises contacting the cell with a composition as defined in claim 18.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US10982229B2|2021-04-20|Methods and products for transfecting cells

---

CN105420232B|2020-07-31|Methods and products for transfecting cells

同族专利:

---

公开号 | 公开日

---

US20160312243A1|2016-10-27|

---

US10829738B2|2020-11-10|

---

RU2018112719A3|2021-07-29|

---

RU2691027C2|2019-06-07|

---

AU2020202780A1|2020-05-14|

---

KR102196339B1|2020-12-29|

---

AU2017225124B2|2019-02-28|

---

US10472611B2|2019-11-12|

---

EP3835420A1|2021-06-16|

---

RU2017118312A3|2018-11-02|

---

US10982229B2|2021-04-20|

---

CN104080482B|2015-11-25|

---

US20160333378A1|2016-11-17|

---

US20190390174A1|2019-12-26|

---

US20200157504A1|2020-05-21|

---

WO2013086008A1|2013-06-13|

---

US20200308544A1|2020-10-01|

---

MX354995B|2018-03-27|

---

AU2019203662B2|2020-01-30|

---

US20190270968A1|2019-09-05|

---

AU2012347919B2|2017-02-02|

---

US9605277B2|2017-03-28|

---

KR20210134808A|2021-11-10|

---

EP2788033A1|2014-10-15|

---

US20150167019A1|2015-06-18|

---

RU2017118312A|2018-11-02|

---

AU2019203662A1|2019-06-13|

---

KR20140109925A|2014-09-16|

---

US20140356906A1|2014-12-04|

---

JP6073916B2|2017-02-01|

---

EP2788033B1|2017-05-31|

---

EP3260140B1|2021-02-03|

---

RU2018112719A|2019-10-10|

---

EP2788033A4|2015-08-26|

---

AU2012347919A1|2014-06-26|

---

RU2624139C2|2017-06-30|

---

KR20210005287A|2021-01-13|

---

CN104080482A|2014-10-01|

---

US10662410B1|2020-05-26|

---

MX2014006663A|2015-03-19|

---

JP6294944B2|2018-03-14|

---

US20170152483A1|2017-06-01|

---

JP2017023156A|2017-02-02|

---

JP2015506673A|2015-03-05|

---

AU2016277545B2|2017-06-15|

---

HK1202443A1|2015-10-02|

---

US20210009955A1|2021-01-14|

---

DK3260140T3|2021-04-19|

---

CN111893140A|2020-11-06|

---

CA2858148A1|2013-06-13|

---

KR102320571B1|2021-11-02|

---

AU2017225124A1|2017-09-28|

---

US9422577B2|2016-08-23|

---

US20200325447A1|2020-10-15|

---

HK1222204A1|2017-06-23|

---

US9605278B2|2017-03-28|

---

AU2016277545A1|2017-01-12|

---

EP3260140A1|2017-12-27|

---

HK1220490A1|2017-05-05|

---

US20170151285A1|2017-06-01|

---

US20200291357A1|2020-09-17|

---

HK1222203A1|2017-06-23|

---

RU2014127505A|2016-02-10|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US2705230A|1949-09-23|1955-03-29|Allen F Reid|Method of purifying albumin|

---

US3539465A|1968-10-08|1970-11-10|Ncr Co|Encapsulation of hydrophilic liquid-in-oil emulsions|

---

FR2322871B3|1975-09-08|1978-04-28|New Zealand Inventions Dev|

---

US5843780A|1995-01-20|1998-12-01|Wisconsin Alumni Research Foundation|Primate embryonic stem cells|

---

AT403989B|1996-09-16|1998-07-27|Immuno Ag|METHOD FOR PRODUCING A PLASMA PROTEIN-CONTAINING MEDICINAL PRODUCT|

---

EP0986635A4|1997-01-10|2001-11-07|Life Technologies Inc|Embryonic stem cell serum replacement|

---

GB9703554D0|1997-02-20|1997-04-09|Dow Corning|Polymerisation of cyclosiloxanes|

---

EP1021549A2|1997-09-19|2000-07-26|Sequitur, Inc.|SENSE mRNA THERAPY|

---

GB9827069D0|1998-12-09|1999-02-03|Dow Corning|Polymerisation catalyst|

---

GB9827085D0|1998-12-09|1999-02-03|Dow Corning|Polymerisation of siloxanes|

---

GB9827036D0|1998-12-09|1999-02-03|Dow Corning|Polymerisation of siloxanes|

---

GB9902000D0|1999-01-30|1999-03-17|Delta Biotechnology Ltd|Process|

---

US20110171185A1|1999-06-30|2011-07-14|Klimanskaya Irina V|Genetically intact induced pluripotent cells or transdifferentiated cells and methods for the production thereof|

---

KR100865706B1|2000-09-26|2008-10-28|이데라 파마슈티칼즈, 인코포레이티드|Modulation of immunostimulatory activity of immunostimulatory oligonucleotide analogs by positional chemical changes|

---

WO2003018767A2|2001-08-27|2003-03-06|Advanced Cell Technology, Inc.|Trans-differentiation and re-differentiation of somatic cells and production of cells for cell therapies|

---

US20050130144A1|2001-09-21|2005-06-16|Norio Nakatsuji|Method of screening reprogramming factor, reprogramming factor screened by the method, method of using the reprogramming factor, method of differentiating undifferentiated fused cells and method of constructing cell, tissues and organs|

---

WO2003033697A1|2001-10-18|2003-04-24|Ixion Biotechnology, Inc.|Conversion of liver stem and progenitor cells to pancreatic functional cells|

---

GB0202149D0|2002-01-30|2002-03-20|Univ Edinburgh|Pluripotency determining factors and uses thereof|

---

GB0202633D0|2002-02-05|2002-03-20|Delta Biotechnology Ltd|Stabilization of protein preparations|

---

US7276489B2|2002-10-24|2007-10-02|Idera Pharmaceuticals, Inc.|Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5′ ends|

---

WO2005002507A2|2003-06-03|2005-01-13|Isis Pharmaceuticals, Inc.|Modulation of survivin expression|

---

US7682828B2|2003-11-26|2010-03-23|Whitehead Institute For Biomedical Research|Methods for reprogramming somatic cells|

---

NZ553235A|2004-09-08|2009-11-27|Wisconsin Alumni Res Found|Culturing human pluripotent stem cells|

---

KR101264940B1|2004-09-08|2013-05-15|위스콘신 얼럼나이리서어치 화운데이션|Medium and culture of embryonic stem cells|

---

TW200740999A|2005-07-15|2007-11-01|Primegen Biotech Llc|Therapeutic reprogramming of germ-line stem cells|

---

JP2009502170A|2005-07-26|2009-01-29|サンガモバイオサイエンシズインコーポレイテッド|Targeted integration and expression of foreign nucleic acid sequences|

---

US8323666B2|2005-08-01|2012-12-04|Allergan, Inc.|Botulinum toxin compositions|

---

PT2578685T|2005-08-23|2019-07-10|Univ Pennsylvania|Rna containing modified nucleosides and methods of use thereof|

---

US9012219B2|2005-08-23|2015-04-21|The Trustees Of The University Of Pennsylvania|RNA preparations comprising purified modified RNA for reprogramming cells|

---

EP3354723A1|2005-08-29|2018-08-01|Technion Research & Development Foundation Ltd.|Media for culturing stem cells|

---

US7485448B2|2005-09-13|2009-02-03|Takara Bio Inc.|Serum-free medium for producing retroviruses|

---

MX352337B|2005-12-13|2017-11-21|Univ Kyoto|Nuclear reprogramming factor.|

---

US8129187B2|2005-12-13|2012-03-06|Kyoto University|Somatic cell reprogramming by retroviral vectors encoding Oct3/4. Klf4, c-Myc and Sox2|

---

US8278104B2|2005-12-13|2012-10-02|Kyoto University|Induced pluripotent stem cells produced with Oct3/4, Klf4 and Sox2|

---

CA2634329A1|2005-12-22|2007-07-19|Csl Behring Gmbh|Octanoate-reduced human albumin|

---

US20090014055A1|2006-03-18|2009-01-15|Solyndra, Inc.|Photovoltaic Modules Having a Filling Material|

---

JP2008077874A|2006-09-19|2008-04-03|Shin Etsu Polymer Co Ltd|Dye-sensitized solar cell|

---

DE102006051516A1|2006-10-31|2008-05-08|Curevac Gmbh| modified RNA to increase the expression of a protein|

---

GB0623635D0|2006-11-27|2007-01-03|Stem Cell Sciences Uk Ltd|Pluripotent cell growth media|

---

US10829733B2|2007-01-04|2020-11-10|Biolamina Ab|Composition and method for enabling proliferation of pluripotent human stem cells|

---

EP2099911A2|2007-01-11|2009-09-16|Yale University|Compositions and methods for targeted inactivation of hiv cell surface receptors|

---

US9249423B2|2007-02-02|2016-02-02|Yale University|Method of de-differentiating and re-differentiating somatic cells using RNA|

---

US8859229B2|2007-02-02|2014-10-14|Yale University|Transient transfection with RNA|

---

US8440461B2|2007-03-23|2013-05-14|Wisconsin Alumni Research Foundation|Reprogramming somatic cells using retroviral vectors comprising Oct-4 and Sox2 genes|

---

WO2008124133A1|2007-04-07|2008-10-16|Whitehead Institute For Biomedical Research|Reprogramming of somatic cells|

---

BRPI0810949A2|2007-05-29|2015-10-27|Christopher B Reid|"Method of preparing multipotent, self-renewing, differentiating or disease resistant cells, cell and vector for use of the method"|

---

JP2008307007A|2007-06-15|2008-12-25|Bayer Schering Pharma Ag|Human pluripotent stem cell induced from human tissue-originated undifferentiated stem cell after birth|

---

AU2008286249B2|2007-12-10|2013-10-10|Kyoto University|Efficient method for nuclear reprogramming|

---

EP2072618A1|2007-12-14|2009-06-24|Johannes Gutenberg-Universität Mainz|Use of RNA for reprogramming somatic cells|

---

SG188904A1|2008-03-17|2013-04-30|Scripps Research Inst|Combined chemical and genetic approaches for generation of induced pluripotent stem cells|

---

US20110045001A1|2008-03-28|2011-02-24|Biontex Laboratories Gmbh|Transfection results of non-viral gene delivery systems by influencing of the innate immune system|

---

EP2275531B1|2008-03-31|2015-12-23|Oriental Yeast Co., Ltd.|Method for proliferation of pluripotent stem cells|

---

WO2009127230A1|2008-04-16|2009-10-22|Curevac Gmbh|MODIFIED RNA FOR SUPPRESSING OR AVOIDING AN IMMUNOSTIMULATORY RESPONSE AND IMMUNOSUPPRESSIVE COMPOSITION|

---

JP2011160661A|2008-06-02|2011-08-25|Kyowa Hakko Kirin Co Ltd|Reprogramming method of blood cell|

---

EP3112456A1|2008-06-04|2017-01-04|Cellular Dynamics International, Inc.|Methods for the production of ips cells using non-viral approach|

---

GB2460552B|2008-06-05|2011-09-07|Iti Scotland Ltd|Stem cell culture media and methods|

---

WO2010008486A2|2008-06-24|2010-01-21|Parkinsons Institute|Pluripotent cell lines and methods of use thereof|

---

US20100184033A1|2008-07-16|2010-07-22|West Michael D|Methods to accelerate the isolation of novel cell strains from pluripotent stem cells and cells obtained thereby|

---

US20110263015A1|2008-08-20|2011-10-27|Virxsys Corporation|Compositions and methods for generation of pluripotent stem cells|

---

US20100076057A1|2008-09-23|2010-03-25|Northwestern University|TARGET DNA INTERFERENCE WITH crRNA|

---

EP2356221B1|2008-10-24|2018-11-21|Wisconsin Alumni Research Foundation|Pluripotent stem cells obtained by non-viral reprogramming|

---

EP2192174B1|2008-11-21|2015-11-11|Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V.|Reprogramming cells toward a pluripotent state|

---

ES2627552T3|2008-12-04|2017-07-28|Sigma Aldrich Company|Genome editing in rats using zinc finger nucleases|

---

US20110239315A1|2009-01-12|2011-09-29|Ulla Bonas|Modular dna-binding domains and methods of use|

---

EP2206723A1|2009-01-12|2010-07-14|Bonas, Ulla|Modular DNA-binding domains|

---

US20100209404A1|2009-02-10|2010-08-19|University Of Dayton|Enhanced method for producing stem-like cells from somatic cells|

---

US10894944B2|2009-04-10|2021-01-19|Monash University|Cell culture media|

---

US10837020B2|2009-04-22|2020-11-17|Massachusetts Institute Of Technology|Innate immune suppression enables repeated delivery of long RNA molecules|

---

WO2010123501A1|2009-04-22|2010-10-28|Massachusetts Institute Of Technology|Innate immune suppression enables repeated delivery of long rna molecules|

---

DK2421957T3|2009-04-22|2021-01-25|Viacyte Inc|CELL COMPOSITIONS DERIVED FROM DEDIFFERENTIATED PROGRAMMED CELLS|

---

US8496941B2|2009-06-03|2013-07-30|National Institute Of Advanced Industrial Science And Technology|Vectors for generating pluripotent stem cells and methods of producing pluripotent stem cells using the same|

---

US20120195936A1|2009-07-31|2012-08-02|Ethris Gmbh|Rna with a combination of unmodified and modified nucleotides for protein expression|

---

CA2777710C|2009-11-04|2021-02-23|Cellular Dynamics International, Inc.|Episomal reprogramming with chemicals|

---

US20110189137A1|2009-11-11|2011-08-04|Sanford-Burnham Medical Research Institute|Method for generation and regulation of ips cells and compositions thereof|

---

CA2783437C|2009-11-12|2020-08-04|Technion Research & Development Foundation Ltd.|Culture media, cell cultures and methods of culturing pluripotent stem cells in an undifferentiated state|

---

JP2013512690A|2009-12-07|2013-04-18|ザトラスティースオブザユニバーシティオブペンシルベニア|RNA preparation comprising purified modified RNA for reprogramming cells|

---

US20130189741A1|2009-12-07|2013-07-25|Cellscript, Inc.|Compositions and methods for reprogramming mammalian cells|

---

JP2013513389A|2009-12-10|2013-04-22|リージェンツオブザユニバーシティオブミネソタ|DNA modification mediated by TAL effectors|

---

US8557972B2|2009-12-21|2013-10-15|University Of Washington Through Its Center For Commercialization|Compositions and methods for transfection of RNA and controlled stabilization of transfected RNA|

---

CA2788635A1|2010-02-01|2011-08-04|The Board Of Trustees Of The Leland Stanford Junior University|Enhanced efficiency of induced pluripotent stem cell generation|

---

WO2011110886A1|2010-03-09|2011-09-15|Biolamina Ab|Composition and method for enabling proliferation of pluripotent human stem cells|

---

EP2558571A4|2010-04-16|2014-09-24|Immune Disease Inst Inc|Sustained polypeptide expression from synthetic, modified rnas and uses thereof|

---

US8883498B2|2010-04-22|2014-11-11|Kyoto University|Method for inducing differentiation of pluripotent stem cells into skeletal muscle or skeletal muscle progenitor cells|

---

US8771985B2|2010-04-26|2014-07-08|Sangamo Biosciences, Inc.|Genome editing of a Rosa locus using zinc-finger nucleases|

---

CN102234627B|2010-04-30|2015-06-03|中国科学院广州生物医药与健康研究院|Culture medium additive and application thereof|

---

WO2011140397A2|2010-05-05|2011-11-10|The Regents Of The University Of California Office Of The President|Stem cell defined media for xeno-free and feeder free conditions and uses thereof|

---

EP2569424A1|2010-05-12|2013-03-20|Cellectis|Meganuclease variants cleaving a dna target sequence from the dystrophin gene and uses thereof|

---

US8048675B1|2010-05-12|2011-11-01|Ipierian, Inc.|Integration-free human induced pluripotent stem cells from blood|

---

KR101953237B1|2010-05-17|2019-02-28|상가모 테라퓨틱스, 인코포레이티드|Novel dna-binding proteins and uses thereof|

---

EP2392208B1|2010-06-07|2016-05-04|Helmholtz Zentrum München Deutsches Forschungszentrum für Gesundheit und Umwelt |Fusion proteins comprising a DNA-binding domain of a Tal effector protein and a non-specific cleavage domain of a restriction nuclease and their use|

---

DK2601288T3|2010-08-05|2016-05-30|Wisconsin Alumni Res Found|Simplified base media for human pluripotent cell culture|

---

US8822663B2|2010-08-06|2014-09-02|Moderna Therapeutics, Inc.|Engineered nucleic acids and methods of use thereof|

---

US20140127814A1|2010-08-10|2014-05-08|Srinivasan Chandrasegaran|Generation and use of pluripotent stem cells|

---

US9447408B2|2010-09-14|2016-09-20|Kyoto University|Method of efficiently establishing induced pluripotent stem cells|

---

EP2625189B1|2010-10-01|2018-06-27|ModernaTX, Inc.|Engineered nucleic acids and methods of use thereof|

---

US20130273656A1|2010-10-08|2013-10-17|Regents Of The University Of Minnesota|Method to increase gene targeting frequency|

---

JP5888753B2|2010-11-04|2016-03-22|国立大学法人京都大学|Efficient method for establishing induced pluripotent stem cells|

---

EP2683812A4|2011-03-07|2014-12-03|Massachusetts Inst Technology|Methods for transfecting cells with nucleic acids|

---

WO2012135805A2|2011-03-31|2012-10-04|modeRNA Therapeutics|Delivery and formulation of engineered nucleic acids|

---

EP3460064A1|2011-04-03|2019-03-27|The General Hospital Corporation d/b/a Massachusetts General Hospital|Efficient protein expression in vivo using modified rna |

---

US9862926B2|2011-06-27|2018-01-09|Cellscript, Llc.|Inhibition of innate immune response|

---

JP2014520551A|2011-07-11|2014-08-25|セルラーダイナミクスインターナショナル，インコーポレイテッド|Cell reprogramming method and genome modification method|

---

CN110511939A|2011-10-03|2019-11-29|现代泰克斯公司|Nucleosides, nucleotide and nucleic acid of modification and application thereof|

---

AU2012352180A1|2011-12-16|2014-07-31|Moderna Therapeutics, Inc.|Modified nucleoside, nucleotide, and nucleic acid compositions|

---

WO2013096709A2|2011-12-21|2013-06-27|modeRNA Therapeutics|Methods of increasing the viability or longevity of an organ or organ explant|

---

LT3144389T|2011-12-30|2018-08-10|Cellscript, Llc|Making and using in vitro-synthesized ssrna for introducing into mammalian cells to induce a biological or biochemical effect|

---

AU2013243955B2|2012-04-02|2018-02-22|Modernatx, Inc.|Modified polynucleotides for the production of oncology-related proteins and peptides|

---

CA2885576A1|2012-04-24|2013-10-31|The Brigham And Women's Hospital, Inc.|Generating pluripotent cells de novo|

---

US10119150B2|2012-05-13|2018-11-06|Allele Biotechnology & Pharmaceuticals, Inc.|Feeder-free Derivation of human-induced pluripotent stem cells with synthetic messenger RNA|

---

DK2850179T3|2012-05-13|2019-06-17|Allele Biotechnology & Pharmaceuticals Inc|FEEDER CELL-FREE DERIVATION OF HUMAN-INDUCED PLURIPOTENT STAM CELLS WITH SYNTHETIC MESSENGER RNA|

---

US10155929B2|2012-05-13|2018-12-18|Allele Biotechnology & Pharmaceuticals, Inc.|Feeder-free derivation of human-induced pluripotent stem cells with synthetic messenger RNA|

---

SI2959005T1|2013-02-22|2022-01-31|The Board Of Trustees Of The Leland Stanford Junior University|Medical use relating to telomere extension|

---

WO2017019010A1|2015-07-27|2017-02-02|Kimberly-Clark Worldwide, Inc.|Disinfectant composition with rapid antiviral efficacy|US8822663B2|2010-08-06|2014-09-02|Moderna Therapeutics, Inc.|Engineered nucleic acids and methods of use thereof|

---

EP2625189B1|2010-10-01|2018-06-27|ModernaTX, Inc.|Engineered nucleic acids and methods of use thereof|

---

EP2683812A4|2011-03-07|2014-12-03|Massachusetts Inst Technology|Methods for transfecting cells with nucleic acids|

---

WO2012135805A2|2011-03-31|2012-10-04|modeRNA Therapeutics|Delivery and formulation of engineered nucleic acids|

---

US9464124B2|2011-09-12|2016-10-11|Moderna Therapeutics, Inc.|Engineered nucleic acids and methods of use thereof|

---

AU2012352180A1|2011-12-16|2014-07-31|Moderna Therapeutics, Inc.|Modified nucleoside, nucleotide, and nucleic acid compositions|

---

CN110511939A|2011-10-03|2019-11-29|现代泰克斯公司|Nucleosides, nucleotide and nucleic acid of modification and application thereof|

---

US9283287B2|2012-04-02|2016-03-15|Moderna Therapeutics, Inc.|Modified polynucleotides for the production of nuclear proteins|

---

US9572897B2|2012-04-02|2017-02-21|Modernatx, Inc.|Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins|

---

AU2013243955B2|2012-04-02|2018-02-22|Modernatx, Inc.|Modified polynucleotides for the production of oncology-related proteins and peptides|

---

US9878056B2|2012-04-02|2018-01-30|Modernatx, Inc.|Modified polynucleotides for the production of cosmetic proteins and peptides|

---

CA2890110A1|2012-11-01|2014-05-08|Factor Bioscience Inc.|Methods and products for expressing proteins in cells|

---

EP2922554B1|2012-11-26|2022-02-23|ModernaTX, Inc.|Terminally modified rna|

---

SI2959005T1|2013-02-22|2022-01-31|The Board Of Trustees Of The Leland Stanford Junior University|Medical use relating to telomere extension|

---

US8980864B2|2013-03-15|2015-03-17|Moderna Therapeutics, Inc.|Compositions and methods of altering cholesterol levels|

---

WO2015048744A2|2013-09-30|2015-04-02|Moderna Therapeutics, Inc.|Polynucleotides encoding immune modulating polypeptides|

---

US10323076B2|2013-10-03|2019-06-18|Modernatx, Inc.|Polynucleotides encoding low density lipoprotein receptor|

---

AU2015210769B2|2014-01-31|2019-02-07|Factor Bioscience Inc.|Methods and products for nucleic acid production and delivery|

---

CA2957532A1|2014-08-07|2016-02-11|Duke University|Compositions and methods for the reprogramming of cells into cardiomyocytes|

---

JP6644702B2|2014-11-14|2020-02-12|Ｊｃｒファーマ株式会社|A therapeutic agent for muscular dystrophy containing pluripotent stem cells derived from dental pulp|

---

CN109477102A|2015-02-13|2019-03-15|菲克特生物科学股份有限公司|Nucleic acid product and its method of administration|

---

CN107787363B|2015-04-24|2021-06-25|哥本哈根大学|Isolation of true pancreatic progenitor cells|

---

WO2017053729A1|2015-09-25|2017-03-30|The Board Of Trustees Of The Leland Stanford Junior University|Nuclease-mediated genome editing of primary cells and enrichment thereof|

---

AU2017312113A1|2016-08-17|2018-12-20|Factor Bioscience Inc.|Nucleic acid products and methods of administration thereof|

---

CN106967686B|2017-03-31|2019-11-08|北昊干细胞与再生医学研究院有限公司|The method and human tissue of the external lengthening of telomeres Multiplying culture of cartilage cell are engineered regeneration of cartilage|

---

CN108728903A|2017-04-21|2018-11-02|深圳市乐土精准医疗科技有限公司|The banking process of thalassemia large sample screening is used for based on high-flux sequence|

---

JP2020530979A|2017-06-30|2020-11-05|インスクリプタ， インコーポレイテッド|Automatic cell processing methods, modules, equipment and systems|

---

CN109280701A|2017-07-21|2019-01-29|深圳华大基因股份有限公司|Probe, genetic chip and preparation method and application for thalassemia detection|

---

CN111372650A|2017-09-30|2020-07-03|因思科瑞普特公司|Flow-through electroporation apparatus|

---

CA2983845A1|2017-10-26|2019-04-26|University Of Copenhagen|Generation of glucose-responsive beta cells|

---

CN108103027B|2018-02-02|2021-12-24|中国医学科学院血液病医院（血液学研究所）|Method for reprogramming blood cells with high efficiency and simultaneously realizing gene editing|

---

CN112368368A|2018-06-15|2021-02-12|扶桑药品工业株式会社|Culture medium for assisted reproductive medical treatment|

---

RU2746162C2|2019-07-30|2021-04-08|Федеральное государственное бюджетное научное учреждение "Институт экспериментальной медицины" |Method of transfection and cultivation of cells synthesizing recombinant protein - glutamic acid decarboxylase|

---

US10501404B1|2019-07-30|2019-12-10|Factor Bioscience Inc.|Cationic lipids and transfection methods|

---

WO2021231549A2|2020-05-12|2021-11-18|Factor Bioscience Inc.|Engineered gene-editing proteins|

法律状态:
2020-11-17| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2021-04-20| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|Free format text: DE ACORDO COM O ARTIGO 229-C DA LEI NO 10196/2001, QUE MODIFICOU A LEI NO 9279/96, A CONCESSAO DA PATENTE ESTA CONDICIONADA A ANUENCIA PREVIA DA ANVISA. CONSIDERANDO A APROVACAO DOS TERMOS DO PARECER NO 337/PGF/EA/2010, BEM COMO A PORTARIA INTERMINISTERIAL NO 1065 DE 24/05/2012, ENCAMINHA-SE O PRESENTE PEDIDO PARA AS PROVIDENCIAS CABIVEIS. |

---

2021-06-15| B07E| Notification of approval relating to section 229 industrial property law [chapter 7.5 patent gazette]|

---

2021-07-06| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2021-12-07| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

US201161566948P| true| 2011-12-05|2011-12-05|

---

US61/566,948|2011-12-05|

---

US201161569595P| true| 2011-12-12|2011-12-12|

---

US61/569,595|2011-12-12|

---

US201261637570P| true| 2012-04-24|2012-04-24|

---

US61/637,570|2012-04-24|

---

US13/465,490|2012-05-07|

---

US13/465,490|US8497124B2|2011-12-05|2012-05-07|Methods and products for reprogramming cells to a less differentiated state|

---

US201261664494P| true| 2012-06-26|2012-06-26|

---

US61/664,494|2012-06-26|

---

PCT/US2012/067966|WO2013086008A1|2011-12-05|2012-12-05|Methods and products for transfecting cells|

---